GenePrediction:GLEAN_6865 Details

Name: GLEAN_6865
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1206088..1203956 (- strand)
Length: 2133
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1206088..1206072 (- strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_108:1206002..1205967 (- strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_108:1205908..1205668 (- strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_108:1205434..1203956 (- strand)
Length: 1479
>GLEAN_6865 class=GenePrediction position=GCSC_108:1206088..1203956 (- strand)
ATGTCTGAATTCTTAGGGTAGGGCACCCAGTCTCCTCATCGCCGGCCTATGTCTGACTCCACACTAATGCATACTTTTGG
TTGTAGAGCGCGTATTTCGCTTATATCCAAGAGTGATATTCGGTAAGCTCAAATGTCTCCTTTCGCTTTGGCCTCGTCGT
CTTCTAATGCTTTTTCACAGCTACTCTGGTGTCCTCCATGAAATCAATTCTGAGGAATCCACAGTCTCCTTGGAGAATGT
TATATCCTACGGCACAGAAGGCCGCCGAGGCAAGCCTGAGGACGAAATTCCACCCGCAGATCAAATCTACGAATACATTG
TGTTCCGTGGCAATGATGTCAAGGACCTGCGTATCGAAGAAGGACCCAGTTCCAAGGAGACGAATCCCAACAACGTGCCA
AATGACCCGGCCATAGTAGGAGTGAGTAAAACGGGTTCTTTCTTTTTATCTCTGCTGTGCACATCATAGCCGGCCTTTCT
GATGAAACATTTTCGGATGTTAAAACACACATTACTGAATTGCGCAAACAATCCCCATGTTGATATTTCCGTTGCCTTCC
TTCTGATCTGGCCCAAAGTGCATCAAATATGTCTACAAAACTGCTGTTCCGGTGCCAGTGTGCTGACCATGTCGTTCTCG
ACTCTCTTCTACAGGCACGTTCACGTCCCATGAACAACAATGCACCCCCGCACTTCCAACAGGGCCCTCTCGGTCCTCAA
GGCCCGCTCCAGCAGGGCGGCCCAGGCTTTGCACCGAACATGCCCATCCCTCCGCATCCCGCCGCCTGGGGTCCCCAAGG
CCCACCTCAAAACTTCCAATATCCCCCTCCGCCTGGCTGGTACCCCCCGCAAGGAATGGGCTTTGCTGCCGGTGGTCCAA
ACCCATGGGGAAACTACTACAACCCTGCTATGGGTCCCTACGGACCTGGCGGCCCTGGTGGCCCTGGCGGTCCGAACAAT
GGTCGCCTACCACCTCAGCAAATCCAGCCGCAACAGCCGCTGCAACACCAGCCGCAGCAGCAGCAGCAGCAGCCACCCAA
GCAGCCGGCTGAGGCTCCTCGGTCGCGGCCATCGCCCGTCAGTGCTAATACTGAAAAGCAAAAGGGCCCGACGACCGCAT
CAGATGTTGAGCCCAAGTCAATTGGCCAGTCTCCGGCACAACAGTTCGCGGGCAGAAATAACATTGTCCCCACCAGTTCT
CGCGGTGGTCGGGTACCGGGTAGTGAGGCAAAAAAGCCTGAAGCGCCGTCGGGTGTTCCCAGGAACGGACCAGCCGAGGC
TTCGCCTGCGGCTACACTGCCAGCGGCCCCGAAGGGCATAACAAGAATTGCACCCATCGTTCCTCTACCTGCCGGCCTCG
TCAGCAAGACGGTAACACAGACGACGATGATCACAAGCAAGCAGACGGGAGATGCGGCTGCCAGCGCGGCGGCGCTTCGT
GATGCAACACAGGCGGCTAAGGCGGCAGTTGCTGTGGCCATGGCTAAGCTTGAGGGAGGCGGCACCTCTGGACCGTCGCA
AACTGCGCCGGCAGTGTCAGGCCAGTTTTCCAACGGCTTTTCTGCTATCGACAACTTGACGCGGAAGGTTAACGAGATGC
GGGTGAACGCTACTCAGCCGACTGGTGCGAGCAACGGACGCACGCGGGGACGCGGTGGCATGGGTGGCGGCCGGGCGCCG
AAGACAGTTCTGCCAGATGCCGACTTTGATTTTGCGACTGCCAACGCCAAGTTCAACAAGGAAGATGTAGTCAAGGAGGC
TGAGCCAAGCAGTGCAGTGGAGTCCTCCGAGGGCGTGGAGGCTGCTGCCGTCGAGGGCACAGACGAGACTCTGCCAGCAT
ACAACAAGACCAAGTCGTTTTTCGACAACATTTCCAGCGAGGCCAAAGACAGGGCCGAAAAGGGCGGCCAGAAGGCTGGT
GGGCGTGAGTGGAGGGGCGAGGAGCAGCGCCGCAACATTGAGACGTTCGGCCAGGGAAGCGTGGACGGTGGCTTCCGGGG
CTATCGCGGGCGTGGACGTGGTCGTGGACGTGGAGGATTCGGCCGTGGACGCGGCGGTGGTGGTGGTGGTGGTGGTGGTG
GTGGTGGTGGTTTCAGGCGCAACAATGAGTCGCACCAGGGCGTTGCTTCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62