GenePrediction:GLEAN_6868 Details

Name: GLEAN_6868
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1176313..1175461 (- strand)
Length: 853
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1176313..1176286 (- strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_108:1176215..1176157 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_108:1176083..1176017 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_108:1175954..1175461 (- strand)
Length: 494
>GLEAN_6868 class=GenePrediction position=GCSC_108:1176313..1175461 (- strand)
ATGGGCTTGAACCTTTTCCGGGTCGTCGGTAAGTTGGCCGCCTGCGGCTCCGCCACCATCGCCGCCCGCAGTCTTGGCTA
ACGCGAGCGATTGCACAGGGGACCTCTCCCATCTCGTCTCCATCGCCATCCTGCTCCACAAGATGGTCCAGCTGAAGGTG
CGTCTGCCCGTCCTCGTTTCCCGCCTCGCCGCTGTGGCCGTTCCGCCGGCTGCGTGCTGACCGATGACAGAGCTGTTCCG
GCATCTCCTTCAAGTCACAGGCGCTCTACTTTATCGTCTACGTGACAAGATACCTGGGTGAGCTTTCCGTCGATGCCTGT
CCTCCCTCGGCACGGCCGTCCCTGCTGACACTGCGGCAGACCTGTTCTCTACCAACAGCATCTACAACGTCATCTTCAAG
ATCCTCTTCATCTCGTCGCAGGGCTACATTCTCTACCTCATGACCACCTCCTTCAAGCCGACGAATGATCCCAACCTCGA
CACCTTCCGCGTCGAGTACCTCCTCGGCGGGGCTGCCGTGCTCGGCATCCTCATTCCGTACCAGTATTCCTTTTCCGAGA
TCTTCTGGGCCTTTTCTATCTGGCTCGAGTCTGTCGCCATCCTGCCACAGCTGTTTATGCTGCAGCGCACCGGCGAGGCC
GAGGCCATCACGACACACTACCTCTTCGCCCTCGGCATCTACCGCGCCTTCTACATTCCCAACTGGATCTACCGCTACGT
GACGGAGCCCACCCACAAAGTCGACTGGATCGCCATTACCGCCGGCATCGTGCAGACCGTCCTGTACAGCGACTTTTTCT
GGATTTACTACCAGAAGGTGTTCAAGGGCAAGAAGTTCAAGCTGCCGGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62