GenePrediction:GLEAN_6869 Details

Name: GLEAN_6869
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1173817..1171993 (- strand)
Length: 1825
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1173817..1172921 (- strand)
Length: 897
Type: CDS
Source: GLEAN
Position: GCSC_108:1172865..1171993 (- strand)
Length: 873
>GLEAN_6869 class=GenePrediction position=GCSC_108:1173817..1171993 (- strand)
ATGACTAAACAGCGTCGGCCATGTCGACGGGCGGCCATTCTTTGGCTGCCGTTCTTACTTATGGCTTCTGCCGCCAACCC
AACACTGGCAAATGGATTGGACATCGGCGAGGCCGCACAACCCGTTCCACCCATACCTCGGACGGCTGAAAGCGATGCAA
GCAGAATAGGCCAATTGGTTCGGAGACTGATAGCAGTAGGCCCCGACATCATAGCGGCCGATGTGCCGGAACAGAGGCGG
CAGATCGTGCGGGCGCTGGAGCAGGACCAAGAAGAGCGCGAGGAGAGCCGGAGGAAGAAGGAGAAGCGGCGAGTTCCAGC
AGCAGCAGCAGCAGCGGCAGCAGCGGCAGCAGTGACCGAGCGGGCACCGATACAGACCGCGGCGCCGACATATCCCGTGA
CAATGCTGGTAGCACGACAAAACGATGGCCAGGTGGCAGCACTGAGCGCGCAGATCCAGTCTCTGTCGCTGGCGTCGTCA
GCCGTCAGCCAGGCCAGCCGGCTGGTTTCGCAGACATCGCAGCAGCTAGCCCAACAGGTGACACAGCTGTCACAATCGAC
CGACCAGCTGTCGCAGTCGATCCGGCAGTTGCAGCAGACGAGCCAACAGCTCCAGCAGTCGGCCCAGCAGGCATCCCAGT
CGGCTCAACAGGCGTCCCAGTTGGCCCAACAGGCGTCGCAATCGGCCCAACAAGCTTCACAGTCGGCCACAAGCGCCATC
ATCGCGGCTCAGGCGTCGGCTGCTAGCAGTGCCAGCTCAGCCATTGCGCTTAGCCTGGCCAGCCTCTCGAGCAGCGTCTC
CCGGGTAATCGCCTCGGCCAGTGCCAGCGCTGTCAACATTGCTAGCCTCGCCAGCAACCAGGTCCAGTCGGCCAAGGCCG
ACGCCACCTTTGCCAGGGTGAGTCAGGCCTTTGTTGTTCTTTCCACCTCCGTCTTTCGCTGACAAGGTTCAGGCTGATGC
TGCCACGCAAGTCAAGCATTCCCAGGGCACAAGCGTGTCGGTGACCCAGGTGGCTCTTGCTGTCGTCGTCACTTTTGTCG
GCTCTGTGCTTCTCACCGCCCTCGGATTTTATCTGGTGACGCGGTGCAGCAGAAAAGGGAGGCGCCTGAACCACCGGAGC
GCAGGTTACCCGCGCGACTTGAAGCTGCAGAATCCTCCTGCAGGGCCGTATAGCAGCAGAACAGGCTACAACAGCAACGA
TATCAACGACGACGAGCAAAGACTGAACCCTAGTGGTAACGGTGGTGGCAGTGGTGCCAACGGACGTAATTCTCAACAGT
CGTCACTGTACAGCCGCAACTCGATGCAGCAGTCCTCCACCAACGCCGGCTTCGGTAGCACGGCCATCAATAGTCCGCCG
CCGCCCAGACGGAAAGACACAATCAATTCGGCCGGTGGTGTCCGTGGCAGGAGCATGACTTCCTTCTCTCTCTTCCCCAA
GACGCAGACACCGGTTGGCCTATCGGGAGAGGCGATCGGAATCGCCGTCGGCAGCAGAGATACGCTGGACATGACGCCGG
CGCTTCGTGGTGATGTTGGTGAAGCCTCTTCGCCCATGTACAAGACAGCCACAATCGTGACGCTTGCGCAGGTCAAAAAA
AGCGGCAATAATCTGACAAGGCCGCCGCCGAGTCTGCAGCAATGGTTGCGCCAGGAAACAATGCGCCCAATCGGCACGGG
TGACGAAGAAATGAGCACAAGTTGGCCGTTTGAAAGAAATCAACAACAGCCACAGACTATGCGAAAGCAGTCCGTCGGCG
CTGGAGGCGTCAATCCCGGAAAAGTGATGCAGCCGGGAGGACCGTTGCCATTAAGAGATTCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62