GenePrediction:GLEAN_686 Details

Name: GLEAN_686
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1431019..1432452 (+ strand)
Length: 1434
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1431019..1431114 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_97:1431175..1431896 (+ strand)
Length: 722
Type: CDS
Source: GLEAN
Position: GCSC_97:1432053..1432452 (+ strand)
Length: 400
>GLEAN_686 class=GenePrediction position=GCSC_97:1431019..1432452 (+ strand)
ATGCTTCATGGACCAAGTCGAGTGGCCGTAGGCACGGCGGCTGGCCGGCGTTTCTTTTCCAGCACGGCGTCTTGCGGGGC
GGATTTTACCCATGCAGTAGGTCACGTGTCTAGATGAGCGATGTCTCTCGCTTGCTCTCTCGCTGACCATTTGCAGGTCA
TTGGCGGAGGTGTGGTTGGCCTCGCCGTAGCACGCGCCCTCGCAGAGCGAGCCGGATCTGCGTCTTGTTCGTCGTCGTCA
TCATCGTCATCCGTCCTCGTGCTCGAACGCCACGCCGCCGTCGGCACGGAGACATCCTCGCGCAACAGCGAGGTCATCCA
CGCCGGCCTCTACTACGGCGCCAACTCGCTCAAGACGCAGCTCTGCATCCGCGGCCGCCGGCTGCTGTACGACTTTTGTG
CCGCGCACGGCGTGCCGCATCGCCGCACGGGCAAGTGGCTGGTGGCCCAGACGGCCGCCCAGCTCGCCGCACTGCAACGC
ATCGACGCCGCGGCCAGAGAGTACAGCCGGCACCACGACGACGCCACACTCTTGCCGCTCCGCTGGGTGAGCGCGGCCGA
GGCCCAGCGCCGCGAGCCGGCCGTGCGGGCGGACGCCGGCGTGCTCGAGAGCCTGGCGACCGGCATCGTCGACAGTCATG
GCCTGATGGCGGCGCTGCAGGGCGGCTTCGAGCAGGCTGGTGGCACGGTCGCGCTCAGCTCGCCAGTGGTGCGGATCAGC
GCGCTCGGCCACACGAAAAAGGACGGCAGTGGCGGTTGGGCCATCCACGTGCGGCCGGTCGGCGAGGCTGAAGAGTTCAC
CGTCGTCGCCGAGACACTCGTCAACGCGGCCGGACTCGGCTCGGCTGACATCTACAACATGATCACCCAGGGAACAGGGT
TCGATAGGGGGAGTGAAGGGGAAGAACGGAGAAACGAAGGAGGAAAAGACGAAAACCAGAAAAAGGAAGAAAAGGAAGGA
GAAGAAGAGTACCACCAACCACCCCCCCTTCGGCTCTACTACGCCAAGGGAAACTACTTTTCCTACGCCGCCAGCTCGCC
CAAGGTCTCCACCCTCATCTACCCGGCTCCTGAGCCCGGCCTCGCCGGCCTCGGCACCCATCTGACCCTCGATCTCGCCG
GCCGCATGCGCTTTGGGCCCGACGTCGAGTGGGTCGATCATCCCTACAACCTCGCCGTCCACGGTGCCGCTCGTCTGCCC
CAGGCCGTACCTGTAATCCGCGCCTACCTGCCCGACATTGATGCCGACGCCCTCCAGCCCGACTACGCCGGCATCCGGCC
AAAGCTCGCACCGGCCGGCCACGGCGCCGCCGACTTTGTCGTCCGCGCGGAACCCGGCTACCACGGCTGGGTCAACTTGC
TCGGCATCGAGAGCCCGGGGCTGACCAGCAGCCTGGCCATCGGCGAGATGGTGGAGGAATTGCTGTACAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62