GenePrediction:GLEAN_6871 Details

Name: GLEAN_6871
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1169412..1165772 (- strand)
Length: 3641
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1169412..1169152 (- strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_108:1168893..1167442 (- strand)
Length: 1452
Type: CDS
Source: GLEAN
Position: GCSC_108:1167388..1165772 (- strand)
Length: 1617
>GLEAN_6871 class=GenePrediction position=GCSC_108:1169412..1165772 (- strand)
ATGGACCTGCCGATCGACCCAAGAGGCGGCCCTCTGCAGGTGGCCATGGCGCTGCAGCTCTCGGGCCAGGAAGGGCCAGT
GCCGCCCGAACTTCCCTTTTACTTCCCCGGCGACGATGAAGCACAGGTGGGAGGAGCCCAGACGGCTGCCCTGACGCTGT
CGTCGGGCCACGCAATGGTCCCGGTTAGCGACGACGAGGCCTTCAATTGCTGGCCGCAGGACGCGATGGATCTCGATTAC
GACACTGAGCTGGCGTCGTGGGTGAACTCGTGGGGCCTTCCGCAGTACCGTTCGCCTTCCCACCAGCCACAGACGTCACA
AGTGAGCCAACAGCAGGACCAGCACCAGCAACATCAACCACAGCAGCAACAACCACAGCAGCACCAGCAACAGCACCAGC
ACCAGCAACAGCAACAGCAACAGAATCAACAGCAGCACCGCCACCACCGCCATCAACACCATCATCGCAGTCAGAGTCAG
CCACACCACCAACAGCATCATCTTCAGCTGTCCCAGCAGTCTGCTACCACGCTCATGTCGGATGCTGCTGAGCCCATGTT
CAAGAACCCCCCTGTGTCTGCCAGCTTTGTCGAGCTGAACACGCCAGCGACCGCAACTCTCGCACGACACGTCCCAGGCC
CGGACGACCTGCTGTTCCCCGATGACGAGACGGTGACTGTGGTCTGCGGAAATGAGGCAGCGGGAGAGATGCAGCAGGCC
GGTGTCGTATCCACAGAAGGCATTGTTCGCCCACAACAGCAACATCAGCAACAACAGCAGCAACAGCAACAGCAACAACA
GCCGGCTCTGCTTGATCTCAACGACCCAGCCACGCTTGATCTCTACGACGAGATGCTGCTCTTCTCTCGTGGCGGCAGCG
GCAAAGCGACGGAATCTCAGCTCGCGTTCAGCGAGTGTGACGCCGCCAAGGAGACCATCCTGCGTCGGCTGGCCATGAAG
CTGAAGCTCAGCTACAGCTACAATCCAGTTCAACGCCGTGCTTGCATCTGGAAGCCACTGGCCGCGGCCGCTGCCACGCC
AAACAAGCGCGCACATCCAACGGAACGGCGACACACATTGGCCAACCCGTTGACCAACTCGTTGACTGGCTCGTTGACTG
GCTCATTAACCAGTCCGCTGACTAATCCGCTGACCAACCCGCTAATCAACCCGCTCATCTTTACGTCGCCGCCAACACCA
CAGGCCTCATACACGGCCCTCGAGGAAGACGACAGCACCGATAGTCCGACTCTGGGCGACCGTCTGTCCAGCAGCTGGAG
CATCTTTCACTCGGGCATCTCGTCGCGGCGACCACGCGGCCGTCGCGGCCCGCTGAGCGCCAAGAGCCGTAAGGACATCA
AGGACCTCGAGTGGGCCGGTGGCGCGTGTTGGCGCTGCAAGATCCTCCGCCGCAAGTGCGATCCCGGCGTACCCTGCAAG
AACTGCCCGGCTCCGGACTTGCGCGAAGACGCGCCGCCCTGGCCGCTGATCGGCTGTCGGCGTGGCAGTCTGCGTGATGC
CATGCCGCCACAGGCCTTGTGCACCAGTTCGCGGGCCTTGCTGTCGTCGGATGGAGACCGGTCTTCACGTCGGCTCTCGG
CCGTGCTTGAATCGGACCAGCCCCAGCCGGACGTGGTGTCACAGTGCTTCCACGAGGCCGAGGCCCAGTGTCTGTTCGAC
AACAAGCTCGTGCTGGAAAACCCGTCCATGTACCTGCGGGCTCACGGCAAGTCTGAGGCGGCCCAGCACTTTTCACAGGC
TATCCGCAACGGGCGGTACCGTGCCAACGAGTCTCTGCAGGCGCACTGTCACGTGCATGAGCGCACAACCACGTACTCGG
AGCTGATTGCTCGCATTGCCTGGGACCTGGCTGACAATGGCGAGAGTCTGTACGTCCTCGAGATCGAATCGGTAGACGGC
TTCATGCTGATGCTGGAGACGGCCTGCGTGTATGAAGTCGAGGTGGGAAATGTGAGTATGGTGTGTGTCTGCTATACTCT
GCATGTGATGTTAATCGCTGCTAGTCTCCAATGGTGGCGTTGTCGATCGTCTGTCTGCGCTGCTGCATGGATGCCCTACG
GCTGAGCGCGGCCAACCTGCTGAGCCGCCAGCTGCATGGAGGCTGCCAGAAGGACCGATGCAGCATCGACTGCCTGCGCG
AGCTGGCCCTGTGCATTGAGACGTACATTGAGGAGCTGTCGCTGCTGATGTTCCGCAAGGTTAATCTGCGTGATCGCCGC
TGGTGGCTGTCGACCTTTTACAGCCTCTGCATCCAGGCGTATGTGCGGCGCGCCCTGCTAGCCATCGAGCAGCAGCAGCT
GTTTCCCGGGATGGACGATGTCGACGTCGATGTGCTGTACAGTAGCCAGTACCTGCATCTGGTCACCGTGCTCTTCATCG
CCGTGTCCTTTCAGTATGACCCGCTCGTGGCCGGCAACGGCGGCCTGCGTCTGCAGCAGGCCCTGCTGGCCGAGGAGGAC
GGTCCGGGCTGGATAGCCAGCTCAAACACCACTTCCAACACAGCATTGACGTCGTCGAGCGTGCCGGAACGCTATTTCGC
CGTCGGCCGAACTGCCTGCGTCGTTGATCAATGGCTGGACGAGGGCATCAAGTCGTCGTACCAGTTCCTCACCCGGCTGC
TCAACATCGGCTCGCTCGACTTTGACATGGGCCATACTGGTGGAAATATCAACAACACGGCCGTGACCATGACCACCTGT
CGGAGCAGCAGCCGATGCGACAACATCATTCTTGAGGAAGGCATGGATGCCGTCCTGCCGCTTCGTCGGCCGCAGCACAA
ACCCGACCATGCCTCTTCCTTTTCCGGCTACTCCACGCCCAACTCGTCGTCCACGAGCTTTGCCAGTTCGCTGTCGGCGT
CGCGGTCCAACGGAATCACGAGCCCGCCGTCGTCCTGTGGTCCGCTCTCGTCCGCCTCGTCGCCCCGGACCTCCCTCTTC
ATGTCGGACCGTAGGAGCAGCATCGGCTCTCTGCCCAGCCGGCTCTCGGTCGCCTCGTTTCCGGCTGCGTCTGTCGACCT
GCACGGTAACGCCCTGGTCCCGCCAGCCGGCAGTACACCAGCCCATCTCTGCACCTGCTGTCCCAAACGGCCGCAGCGCT
TCGACACCGCCGAGGAGCTGCGGCTGCACCAGACCAAGAAGCCGCACATCTGCGCCTTCTGCGGCCGCCGCTTCAGCCGC
ATGAACGAGGCCGAGCGCCACATCACCACCATCCACCTGCGCCCCTTCTCCTGGTCGTGCGGCCGTTTGCGCAAGCCGCT
GCGTGCATATCAATGCGTCACTGACGGAAACGCCGCCTTTGACGTCTGCGGCTTCTGTGGCCGTCAGTTCCAGCGTCCGG
CCGGCCCAGAAGTCGACGGCCATAGCCAGGATGGCCAGGATGGTCAGGAGGGGGACAACCAAAACATCCAGAGCACCCAG
AACAATGAACGGCTCACTGCTCACATCGAGCAGGACCACAAGCTGCACGAGTGCAAGGCCAGGGGCAAGAAGTTCTTTCG
CGAGGACATGTTTGGACAGCACCTGAAGCTGTCGCATGCAGCTGAACCGGGCATCTGGCTCAAGTATCTGGAAAACGTCT
GCAAGGCCGACGAGAAGGAGAAGCCGGCCGAGGAAGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62