GenePrediction:GLEAN_6873 Details

Name: GLEAN_6873
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1159413..1158736 (- strand)
Length: 678
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1159413..1159403 (- strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_108:1159255..1158736 (- strand)
Length: 520
>GLEAN_6873 class=GenePrediction position=GCSC_108:1159413..1158736 (- strand)
ATGCCTTCCAGGTTTGTCCTTTTTACTTTTCTTTGACTCATACCTGCGTCCAACAGATGTTTAGCTGCGATGGCCATTTC
GTGTACAGCACCAGATCATTTCCCTTGCTTTTGTCCTAATACACTAGAGACATGCTGAAAAATCTGACGATTGCTCAGGA
ATGATCCGACAGACGCTCAGACGTTAAGTAACACCAACAGCACACCACACAACGGAAACATTCTCAGTGGTAATAAGATC
ATCGCCAACTTGACGACTGCAATGGTGGACCATGGCACAGGTGCACCCGCTGAGCAGGCCCAATATGATCTTGGGGACAA
AAGCTTCACGGGGCCTCCAAACACGCCCCAAAACTTATCCACAAGTAATGCGGAAAGCCTCGAGGTCAAAATCGGGGAAA
ACTTGTCCCAGTTTGCTGCCACTACCGAAGTAGACGATGAAGCCAGGGCCAGGGGTGAGGCAGCTCTTCAGCAAGTGCGT
CTTCGGCGGCTTCTTGGGGGATCGAATTGGAGGGTCGACAGAGTCTCTGTACTGACCGGTGATGTTCCGGAGAGGCGAGC
TCATAGCGTCTTGTATGCCTTGCGCTATGCGCTCGCATCGGACCTCTTGTGCGAGTACGTGACGGATACCCTGGAGCAAA
ATGGGAATAATGAGCTGGTGGACGAAGAGCACATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62