GenePrediction:GLEAN_6875 Details

Name: GLEAN_6875
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1155172..1153077 (- strand)
Length: 2096
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1155172..1155007 (- strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_108:1154923..1153077 (- strand)
Length: 1847
>GLEAN_6875 class=GenePrediction position=GCSC_108:1155172..1153077 (- strand)
ATGTCTAAGGCTTCGATTCCGCCTTCCGCCCCGGACCCCGTCCGTCGGGCGCTGCCCTACAAGGACTTTCTCCAACCAGC
TCTGCATCGACGGTTTACCTCCACCGCGGCCGTGCTGCTGGCCACTTCTTACGTCCTCTCGCTGTCGGTGTCTAGCTGGT
CATCATGTACGTGGGCTGTTTGTTTTTGTTTCTTCTGTTCTTCTATCCGTCTGTCCTTTGGTTCCTCTGACTGTATGCTA
ACATCCCAGGGCTTTGGGCTTGGATCCCCTTCAGCAGTGCCGGCTTTCGTGCCTACACCATCTTCTTTTGCGGCCTCATC
GTCATCATCCTGCGGATCGCCCAGTATCATATCGGGATTCGCACGTCGACGTCGCCTTTTGAAACCTTTCTCTACAACGC
CCCCAAGCCCAAGACGGCCGAGACGCTCTTCTCCTACTGCCTGTCAGGCTGGTTCTACGGCCAAATCTTCCGCTGGTCGG
CGCCCGAGAGCGCCCAGCTCAGCTGGATCCTGCACATCTCGGGCGACCGCACCCGGCTGAACGAACGGCCACTGTTCCTG
GTCGTCCACCTGGTCGTCGTCGGCACCCTGCACGCCGTCCTGCACCTCTTCTACGACAGCGACCGGCTGCTCCTGGGAAC
GGCCAGGCCAACATCAGGCAGCAGCAACAGCAGCTCCTCTACAACCAACACTCCCAGCCACGGACGGACCAGCCAACTAT
ACCGCCAACTGGTACTGCGGCTGCCACTGTTGGCGATCTCAGCCTTTACGCGGGCGCTGGCATCGCTCTTCATCAGCGTG
CCCGTCTACATGCTCTTCCTCCGGGCTCCGGCCTGGCGGCTTACCCTCTCGCTCTTCCGGCCGTTTTACAGCCTGCCCAA
GTCGTCGCTGCCGCCCATGGCGACGCCGTTCGGGTCGACGCTCGACTTTGTGCCGCGCTGCATGTTCGCCGGCTTTCTCT
TTTCCGTCCTGCTGCTCGTCAGCAACACGGCCTTTTCGCTCTTCCTGGTCAACGAGCCGCTCAAGGACGGCCGGCCGCTG
ACGTCCGAGTCCCGCGACCCCAACGGCAGCCTGCTGAATGGGCTGCGCAGCAAGAAGCCCAACGTCAAGGCCTTTGCCCT
GTGGGAGCTGGCTTTCATCGCCCGCGACTTTGCCGACTGCCGCATGGCCATCTACACGGACATTGACCGCAAGAACGGGC
CGGCCTGGTCGCAGATCTGCAAGGTCTGTCTGGACGTGGTGGCGAGCCTGGAGGCACGCGTAGACCCGCGGCAGCAGGCG
ACCAAGGAGGCGGGAAGCGAACCGAGACAAGCACAACAGCAGCCGACAGCTGACGAGGACGCAGCCGCTCTGCAGCGGCT
GGCGAGGCCGATACACAAGGACACCGGGATCCTGGTGACGACGCCGACCAAGAAGAACAAGTTCCAGAGCGAGGTCGAGA
AGATGGTGGTCAAGGTGGCCATCGACCCGGAGTCGCCGCCCCGATTGAGTCCGCTGGCGCAAAAGGCCCTCGGCGGTGCC
CGGCGCCGGCTCGAGTCGGTGCAGCGCGACATGAGCAGGCCCGGGAACGGTGGCAGCGCCGTACAGCAGCTGGCACGCCG
CGTCCTGACACTTCCGGTCGTCGGCTGGCCGTTCCGGCTGACTTTTCGGAACCGCATCACGGCGGCCGTGCTCGGCGGTC
CCTACGGCGAGCCCAGCATCTATGTCAACGCCATCAGCGCGCTCAGCCTGCTGGCCGTGCACAGCTTGCAGGAAGACAAG
TTTGGCAACGTGCAGCGCGACGTTGCCACCGTCGTCCGCGCCCTCACCAGCGCCACCACCCGGCTCGACGCCTTCCGCGC
CACCTTCCCGGTGCACTGGACCGACGTGCTCGCCGAACGGTCCTGCCCCGAGGTCGACGACATCCGCGCTGCCCTCAAGG
ACGGACTCACTGACTTGCTGGCCAGCTTCGGCCAGTACAGCCGCGACCTGCGACTCAGCAAAACAGACATTCGCCTGGCC
GAAGAGGCAGCTTCGGCAGGGCGGCCACGCAAGGCAGAGGAAACAGACAAGGCAGAGAAGTCGGACAAGACTGATAAGAA
GGTGCAGGTTCGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62