GenePrediction:GLEAN_687 Details

Name: GLEAN_687
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1436726..1438905 (+ strand)
Length: 2180
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1436726..1436752 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_97:1436826..1436961 (+ strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_97:1437047..1438905 (+ strand)
Length: 1859
>GLEAN_687 class=GenePrediction position=GCSC_97:1436726..1438905 (+ strand)
ATGCTGGCAGCACGCTTCTCCAGAGCCGTAAGTCAATTCCGTCCACCAGCTAGTGTTTGGTACACTTTATCCCGTATTCG
ATGCTGACTGTCGAATCTAGCTTCCCCGGGCAACCTCAGCAGCCTCGCGCTCTGCAGGCATGATGAGCGCAAAGACCTTC
CGTCCAGCCTTTGCCCGCTTCGAGTCCACCTCTTCGGACGAGAAGGTCAAGGGCTCTGTCATCGGCATTGATCTCGGTAA
GTCGCAGTACGCTTCTCTGCCAAGGGCGGAGTCCTCGGAACATACAAGCACCAGTGACTAACATATCTTCCCCGTCTCCA
GGTACGACAAACTCGGCTGTGGCCATCATGGAGGGCAAGATTCCCAAGATCATCGAGAACTCCGAAGGTGCGCGGACGAC
GCCGTCGGTTGTTGCCTTTACCGAGGAGGGCGAGAAGCTTGTCGGTGTTGCCGCCAAGCGTCAGGCTGTGGTCAACCCCG
AGAACACCCTGTTCGCCACCAAGCGGTTGATTGGCCGCAAGTTCACCGACGCTGAGGTGCAGCGTGATATCAAGGAGGTG
CCCTACAAGATTGTGCAGCACACCAACGGTGACGCCTGGGTTTCGTCCCGCGGCAAGAACTACTCGCCGTCGCAGGTCGG
TGGCTTTGTCCTCCAGAAGATGAAGGAGACGGCCGAGGCGTACCTCAGCCGCCCGGTCAAGAACGCCGTCGTCACGGTCC
CGGCCTACTTCAATGACTCCCAGCGCCAGGCCACCAAGGATGCTGGTCAGATCGCCGGCCTGAACGTGCTCCGTGTCGTC
AACGAGCCTACGGCTGCTGCTCTTGCCTACGGTCTTGAGAAGGAGGCTGACCGGATCATCGCCGTGTACGACCTTGGTGG
TGGTACCTTTGATATCTCGGTCCTGGAGATCCAGAACGGTGTGTTCGAGGTGAAGTCGACCAACGGCGACACCCACCTGG
GTGGTGAGGATTTTGATATTCACCTGGTCCGCCACATTGTCGAGCAGTTTAAGAAGGACTCTAGCATTGACCTGTCGGGT
GACCGCATGGCCATCCAGCGCATCCGCGAGGCTGCCGAGAAGGCCAAGATCGAGCTGTCGTCTTCGCTGCAGACGGACAT
CAACCTGCCCTTCATCACGGCCGATGCTTCCGGCCCCAAGCACATCAACACCAAGCTGACGCGTGCGCAGCTGGAGAAGC
TGGTCGACCCGCTCATCACCAAGACGATTGAGCCGGTGCGCAAGGCGCTGAAGGATGCCAACCTGCAGGCGAAGGAGATC
CAGGAGGTGATCCTGGTCGGTGGCATGACCCGTATGCCCAAGGTGTCGGAGTCGGTCAAGAACATTTTCGGCCGCGACCC
GGCCAAGTCGGTGAACCCCGACGAGGCTGTCGCGATCGGTGCGGCCATCCAGGGTGCAGTGCTGTCGGGTGAGGTCAAGG
ACCTGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTATTGAGACGCTCGGCGGCGTGTTTACGCGCCTGATCAACCGC
AACACGACGATCCCGACGAAGAAGTCGCAGGTGTTCTCGACCGCGGCAGACTTCCAGACGGCGGTGGAGATCAAGGTGTT
CCAGGGCGAGCGCGAGCTGGTCAAGGACAACAAGCTGCTGGGCAACTTCCAGCTGGTGGGCATCCCGCCGGCGCACCGCG
GCGTGCCGCAGATCGAGGTGACGTTTGACATTGATGCGGACTCGATTGTGCACGTACACGCCAAGGACAAGTCGACGAAC
AAGGACCAGTCGATCACGATCGCGTCAGGCTCGGGTCTGTCGGACTCGGAGATCCAGCGGATGGTGGATGAGTCGGAGAA
GTTTGCCGAGCAGGACAAGGCGCGCAAGGACGCGATCGAGGCGTCGAACCGGGCGGACAGCATCCTGACGGACACGGAGA
AGGCGCTGACGGACCACGCGGACAAGCTGGACAAGACGGAGACGGACGCGCTGCGCGAGAAGATCACGGCGCTGCGCGAG
TTCATCTCCAAGAGCCAGTCGGGCGAGGGCAACGCGACGGCCGAGGAGATCAAGGAGAAGGTCGACGAGCTGCAGAACGC
CAGCCTGAACCTGCTGGACAAGGTTCACCGCGCGCGTGGCGAGGAGAACACGACGCAGGAGAGCCAGCCGGCCGAGGACG
ACAAGAAGGACAAGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62