GenePrediction:GLEAN_6880 Details

Name: GLEAN_6880
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1128732..1126896 (- strand)
Length: 1837
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1128732..1128698 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_108:1128519..1128497 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_108:1128425..1128198 (- strand)
Length: 228
Type: CDS
Source: GLEAN
Position: GCSC_108:1128111..1128065 (- strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_108:1128000..1127914 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_108:1127854..1127021 (- strand)
Length: 834
Type: CDS
Source: GLEAN
Position: GCSC_108:1126961..1126896 (- strand)
Length: 66
>GLEAN_6880 class=GenePrediction position=GCSC_108:1128732..1126896 (- strand)
ATGGCGAACCAGACTCCGGCCGTTGTCATGGACAAGTAAGCGATACCCGTATCCTGGGACCCCTTTCTACCAGCCAGCCT
CCTTTGCCGAGACCGTCCGTTCCGTATTGCTCCCTGTCGGCAGGGCCATCCAGAGACAGCTACAGCGCGAGGATTTCATC
AAGCAGGACTGTTCTGGAGCCGATTGCTAACATTTTTTTCTCCTCACGCTCAGCGGCACGGGTTTCTCGAAGCTGGGTAT
GTTTAACGTCCTATCACTGGTGCCTAGACACGTGGGCATTACTAACGGTCCGACTCGTATCATATAGGATTTGCTGGAAA
CGACTCTCCTTCCTTCGTATTCCCGACAGCAATTGCAACCAAGGCAACTGGGGGTGGCGGCGGCGGTGCCGGCGGTGGCC
GGCCGGCAGTTGGAAGCAAGCCATCCTTCCTGACCGGTGGCGCTGGCCCGTCCGGCCACATGTCATCGAAGAGAGGAACC
GAAGATCTCGACTACTTTATCGGCGATGAAGCTATAGCAGCAACGTCTGGTCCGGGTAAGATCGAACTCGACCACAGGGC
GTACAGATGAGATGGCGGGTTGGATGCGGTGAGAACTGGCAGCTAACGACGCTCCTCTTAGGATACGGACTGCACTATCC
CATCCGCCACGGACAGATAGAAAATTGGGTGAGCATACTTGAGGAAGCCTAATGGGCGCGGCGATACAACGCACGAAGCT
AACACGAGGCAGGATCACATGGAACGGTTTTGGTCGAACTCGATCTTCAAGTACCTCCGGGTTGAGCCAGAGGACCACTA
CTTCCTACTGACGGAGCCTGTAAGTCTTGGGTCTCGATTGTTGCTGGCATTGGCAGACGCGTGGCTAACAGGTCGCAGCC
TCTGAATCCGCCCGAGAACCGCGAAAACACGGCCGAGATCTTCTTCGAATCCTTCAACTGCGCGGGTCTGTACATTGCGG
TGCAGGCGGTGCTAGCACTGGCGGCATCGTGGACGTCGTCCAAGGTGCAGGACCGCTCGCTGACGGGCACGGTTATCGAC
TCGGGCGACGGTGTGACGCACGTGATTCCAGTGGCGGAGGGCTACGTGATCGGTTCGTCGATCAAATCGATTCCGATTGC
GGGGCGCGACATTACGTACTTTGTGCAGTCGCTGCTACGCGACCGGGGCGAGCCAGACTCGTCGCTCAAGACGGCGCAGG
AGATCAAGGAGGAGTTCTGCTACGTGTGCCCAGATATTGTCAAGGAGTTTGCGCGCTATGACCGGGACTCGTCGCGGTTT
GCCAAGTACAACGCCGTGCAGTCAGGGCGGCGGCAGGTGACGGTGGACGTTGGGTACGAGCGGTTCCTGGCGCCGGAGAT
CTTTTTCAACCCGGAGATTTACAGCTCGGACTTCCTGACGCCGCTGCCGGTAGTGGTCGACAGCGTGATCCAGTCGTCGC
CCATTGACGTGCGGCGTGGCCTGTACAAGAACATTGTGCTCTCGGGCGGCAGCACGCTGTACAAGGACTTTGGTCGGCGG
CTGCAGCGCGACATCAAGCAGTTGGTGGACGCGCGCATCCGAGCGAGTGAGCAGCGCAGCCGCGGTGCCAAGAGCGGCGG
ACTCGAAGTGCAGGTGATTACGCACAAGCGCCAGCGGCATGGTCCTTGGTTCGGTGGCAGTCTGCTGGGACAGACGCCCG
AGTTCCGGTCCTACTGCCACACCAAGGCAGAGGTAAGCATATGTGTTTTTTCTGTTGTGTTGTTGCTATCAATTCTGACG
AACAATCGCAGTACCAAGAATACGGACCCGGTATTGTTCGGAGATTCGCACTGCTGGGCGGTCCCGGCGGCTCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62