GenePrediction:GLEAN_6881 Details

Name: GLEAN_6881
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1124554..1123431 (- strand)
Length: 1124
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1124554..1124494 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_108:1124431..1123431 (- strand)
Length: 1001
>GLEAN_6881 class=GenePrediction position=GCSC_108:1124554..1123431 (- strand)
ATGGCAGCACCAGAGATCCCAACGGAGCAGTGGGCACAGGTCATCGAAGTGTCGGGCAAGCGTGAGTTTTTTTCGCCTTC
ACAGTCTTCTCAATGCTTGGTTTGACCATGCTGACACTGCCAGCCCCCGTGTACAAGAAGATTCCCGTGGGCAAGCCGGC
CGCCGATGAGGTGCTGGTCAACGTCAAATTCTCGGGCGTGTGCCACACAGACCTGCACGCGATGAACGGCGACTGGCCGC
TGGATCGCAAGATGCCGCTGGTGGGTGGCCACGAGGGTGCCGGCGTGGTGGTGGCCAAGGGCAACTTGGTGAAGGACCTG
GAGATTGGCGACCACGTGGGCATCAAGTGGCTGAACGGCTCGTGCCTGGCCTGCAGCTTCTGCAAGCAGATGGACGAGCC
GCTGTGCCCGCACGCCACCCTGTCTGGCTACACAGTCGATGGAACCTTCCAGCAGTACGCCGTTGCCAACGCGGCCCATG
TGGCGCGCATTCCCAAGCACCTGCCGCTGGAAGCCGTCGCACCAGTTCTCTGTGCTGGTATCACCGTGTACAAGGGCCTG
AAGGAGTCGGGTGTGCGGCCTGGCCAGTTCGTCGCCATTGTCGGTGCCGGTGGCGGTCTCGGCAACATGGCTCTGCAGTA
CGCCAAGGCCATGGGCATTCACACCATCGCCATTGACGGCGGCGATGATAAGCGTGTCAGCACGCTCGCTCTGGGTGCGT
CTGCCTACGTCGATTTCATGACCAGCAAGGACCTCGTGGCCGACGTCAAGGCCGCCACTCCCGACGGCCAGGGCCCCAAC
GGCGTCATCTTGCTGGCAGTGTCGGAGAAGCCGTTCCAGCAGGCGGCCGAGTACGTGCGCCCGCACGGCACCGTCATCTG
CATCGGCATGCCGGCCAACGCCTACCTCAAGGCACCCGTCTTCGACACGGTCGTGCGCATGATCACAATTCGCGGCAGCT
ACGTCGGCAACCGCCAGGACTCGGCCGAGGCTATTGACTTCTTCGCCCGTGGCTTGATCAAGGCGCCATTCAAGGTCGTC
GGTCTCACGGAGCTGCCGTCTATCTACGAGATGATGGCTGCAAACAAGGTTGTCGGTCGCTACGTCGTCGACACTAGCAA
ATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62