GenePrediction:GLEAN_6884 Details

Name: GLEAN_6884
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1103372..1102450 (- strand)
Length: 923
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1103372..1103311 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_108:1103217..1103128 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_108:1102955..1102621 (- strand)
Length: 335
Type: CDS
Source: GLEAN
Position: GCSC_108:1102475..1102450 (- strand)
Length: 26
>GLEAN_6884 class=GenePrediction position=GCSC_108:1103372..1102450 (- strand)
ATGACTCTCTCCGACGAAGAGCTTGATCGTGACTGGAAGCCCAGTGGGCGCCGGCCCCAGTCGTATGCAGTTCCCTCCGG
TTTCCCCATATACTGTCCTCTTCTCCCTGGGGACATGTAAACCCCGAACGATGCTGATGATGGCCTCTCTTCTAGAACCA
TTGCGCGCTCCTTCTCCCTGGAGCTGATGGACATATTTCGTATTGAAAACAGTGTTGCCGACTTAGACGAGCAGGTAGAC
AAGCGGTGAGCAATCCTTCCCCCCAGGGTCCTCCCCCCCCCCCCCCTTTTACTTTTTATTTCTATATAATGCCTCTCTTA
GCCGGGAGGCTGCTTCCGGACGAAAACCTGGAAGTTTCATAAGCGAAAGCTAGAACCGTTTGCTAAATATGGACTTCTCT
TTCCGCCTCCCTCGCAGGAAACAGATAGTTACTACCAAGGCGAGCGAGCTCGAGGCCATTGAGAACCGCCTCCGTGAGAT
GGAGACAAGGCTGAATGGTGGAAATCCGGTGGCAACAAGTAAATCGTCTGCCGCCGAAGTCGCCGCAGCTATATCCGCCG
CCCATGCCGCGGCCAGAGACGTACAGGCCCAGGCCCAGGCCCAGGCCCAGGCCCGGGCGCTCGAGCATCGCCCACGCGGC
CATCAGCAGCAGCAAGAGGCTCAGAAGCACAGTGGAAGCCGACCAGGAACAGCACGGACAAGCCAACAGGCAGCGCCGGG
GGCCCTGCCGCCAACGCCCGTGGGCAGCGAGGGTGAGTAAACGAAACAGGCGTTTGGGGGTGGAAGAAGGCTGCGAAAGT
GGGAGAAGTGGAGAGGAGGTGCCACCCCGTCTGGCAAAAAAGGCGCGCAAGAACGAGAACATCTGATCTGACGGTTCTCT
CTGTCCCCTTTGACTAGACGGTGACAGCGAACACGATGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62