GenePrediction:GLEAN_6885 Details

Name: GLEAN_6885
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1095029..1093163 (- strand)
Length: 1867
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1095029..1094928 (- strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_108:1094864..1094565 (- strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_108:1094498..1094426 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_108:1094349..1093163 (- strand)
Length: 1187
>GLEAN_6885 class=GenePrediction position=GCSC_108:1095029..1093163 (- strand)
ATGGCGGGGCTATCTAACGGAGCAGCGGCGGCGACTGCCGACGGCGACCAGACACACACGGCATCGCAGCGGTATCTGTC
GACGCGGGGTGAGGATGAGAATGTGCGTCTTGTTCCCTGAACAGTGGTTGGTGACCCAATGCTGACAGTGTGATCTGGCC
TGTAGCTATCGTTCGAAGAGGTAGTTCTGCAGGGACTTGGCTCGGATGGCGGCCTTTTTATCCCCCACGAAATTCCTACG
GCCAAAGACTGGCAGAGCTGGAGCGAGCTGTCCTTTCCAGAGCTGGCCTTCCGTGTTCTGTCTCTGTATATCTCGCCGTC
CGAAATACCATCAGCCGACCTGCAGGACATTATCAACCGCAGCTACGCGACGTTCCGGGCTGAGGACGTGACTCCTCTGG
TGCACCTCAAGGACAACCTTTACCTGCTCGAGCTGTTCCACGGACCGACGTTTGCCTTCAAAGATGTACGAGGTCTCTCA
GCAGGAGTAAGCGGAGCCATTATTGCATGCTGACCTTTGTTCTCTGTCTAGGTGGCCCTCCAGTTTCTGGGCAACCTGTT
CGAGTACTTCCTTGTTCGGAGGAATGAGGGCAAGACAGGACGTGGTATGTCTGCAGTTTGAATTCTATTTCTACCGGTTT
ACCGCTGACCGGCATGATCCAGACCGTCATCATCTCACAGTGGTCGGTGCGACGTCTGGCGATACGGGCAGTGCTGCGAT
CTACGGTCTGCGCGGGAAGAAGGACGTTTCGGTGTTCATTCTCCACCCGAAGGGCCGTGTCAGCCCGATCCAGGAGGCGC
AGATGGCGACGGTGCTGGACAAGAACGTGCACAACTTGGCAGTGACAGGCACTTTTGACGATTGCCAGGACATTGTCAAG
GCGCTGTTTGCGGATGCAGAGACGAACAAGACGCTGCGGCTGGGCGCGATCAACTCGATCAACTTTGCACGGATCTTAGC
GCAAATCACGTACTACTTCTACTCGTACTTCTCGCTGGCCAAGAAGCTGCCAGCGTTCAAGGTGGGCGACAAGCTGCGCT
TCGCCGTGCCGACGGGCAACTTTGGCGACGTGTTGGCAGGCTACTTTGCGTACCGGATGGGCCTGCCGATCGACAAGCTC
GTGATCGCGACGAACGAGAACGACATCCTCGACCGGTTCTGGAAGACGGGCCGATACGAGAAGCAGCAGCAGCCACAGGA
GGGCAGCGAGGCGGCAGCGGCAGCAGCAGCAGCGGAAGCGACGGCGGCCCCGGCCGAGGGCGTCCTCGTCAAGGAGACGC
TGAGCCCGGCCATGGACATCCTGGTGTCGAGCAACTTTGAGCGGCTGCTCTGGTTCCTGGCTTACGAATTTGCGGCCAGC
GCGGGCATGGACGACGCGTGGAACAAGAAGCAGGCGGGCCAGGAGGTGGTTGTGTGGCTGCGCGACCTCAAGACAAAGGC
CGGCTTCGGGCCGGTGTACAAGGACGTGCTGGAGGCGGCGCGGCGGACGTTTGAGAGCGAGCGGGTCAGCGACGAGCAGA
CGCTGGACACGATCCGGCGGACGTACGGCGCCACGGCCGACAACTACGTTCTGGACCCGCACACAGCCGTTGGCGTGACG
GCAGCCGAGCGGTCGATTGCCCGCGCAGGCACGGATATGCCGCACATTGCGCTGTCGACGGCTCATCCGGCCAAGTTTGC
CGGTGCCGTGGTGACGGCGCTGCAGGGCGAGGCCGGCTTCGACTTTGACAACAACGTGCGGCCGGCCGAGTTCGTCGGGC
TCGAGGAGAAGGAGCGTCGCGTGACCCAGGCCGAGAACGACTGGAGGGCCGTTGGCGCGCTGGTCCGCCGGCAGGTGGAG
GAGGAGCTGGCTGCGGCCGAGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62