GenePrediction:GLEAN_6888 Details

Name: GLEAN_6888
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1087208..1086622 (- strand)
Length: 587
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1087208..1087151 (- strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_108:1086928..1086719 (- strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_108:1086647..1086622 (- strand)
Length: 26
>GLEAN_6888 class=GenePrediction position=GCSC_108:1087208..1086622 (- strand)
ATGGCGCCCGCAAACACTGGTGCGAAGAAGCAGAAGAAGAAGTGGTCGAAGGGCAAGGGTAAGTCAAATGAACCGGACGC
CAGATGAACATTGCTGGACGAAATGGCAAAAGCGCGCAACACCTCATGACGTCGCCTGATGCGCATGCGGTGTCGATAGT
TGCAAATGGACCAAGTCCATCTGTGCCCGGCGATACTGCATTCGGGCGACGCGAATGAGGAGTACCCGCGCCTTCATGTA
GCGAAGATCGTGACGCTAATGTGCTTCTCTTGCTCTGCAGTCAAGGACAAGGCCCAGCACGCCGTCATCCTCGACAAGTC
CACTTCCGAGAAGCTGTACAAGGATGTGCAGTCCTACCGCCTCGTCACCGTTGCCACCCTCGTCGACAGACTTAAGATCA
ACGGTTCCCTGGCACGGAAGTGCCTGAAGGATCTTGAGGAGAAGGGCCAGATCAAGCAGGTCGTCAGCCACAGCAAGATG
AAGATCTACAGTACGTCAACGACGCCGCGAGACAAGATTCTTTGAGACGAGACGAGAACCTTTATGCTAACAGTAGGACA
GCTCGCGCCGTTGGTGGCACTGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62