GenePrediction:GLEAN_6889 Details

Name: GLEAN_6889
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1085127..1083489 (- strand)
Length: 1639
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1085127..1085089 (- strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_108:1084712..1084691 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_108:1084587..1084511 (- strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_108:1084348..1084103 (- strand)
Length: 246
Type: CDS
Source: GLEAN
Position: GCSC_108:1084040..1083489 (- strand)
Length: 552
>GLEAN_6889 class=GenePrediction position=GCSC_108:1085127..1083489 (- strand)
ATGACTTCCAAGGAGGACATTCGCATCTGGGGCATGCCCGTAAGTATAATTCTCTTTACCGACGGTTTTCTATCGACTTG
CCGCACCGGAATTCCCTCACATATTGCGAACACAAACAAACAAAACACAAATGCATCACAATTCCTCTCCCACACTTCTC
CCCCCCAGACCGGTCGAGCTGTCAGACCGTCGGAACGGGTGGAATCCAATTGGCGATTTATCTCAATTGGATGCCCACCG
GAGCTTTGTGCGCTGTGGGATACCAGCAACGGCATGAATTTAGGCGAGCAATGCCCTACTTGCAGTCGCGGTTTGCTGGC
GTCCCATCTCGTCGCATTGCTTCACCCCTACCTCAATGGCACCGCTTATATTCATCCGATTGGAATCAATTTAACTAACC
ACGATATATTCTCAGCCCTTCGTCATCGACTTCTTGAGTATGTTTTCCATCCCGTGGATTCCTACTTCTCCAGAGTGACA
GCTCCGATACATCGGCGTCTTTCGTCGTCGCTTAGTGAGCAGCCTACTGACAGTACACAGTGGGCGGTGTCTCTGCCGCT
GTCTCGAAGACCGCTGCCGCTCCCATTGAGCGTATCAAGCTTCTCGTCCAGAACCAGGTATGCATTTGTTGAGCGATGTG
GCCCCTGTATTAGCGTCTGTAACGGCATTGCCGTAGCAGGTTAGCGTCTGGTGGCCCATGCCCGACGAAGGGCTGCAAAA
ACTATGGGGCACGCTTTGGCGTTATGCATATAACGTATCGTTTCTAACAGCCGAATTAGGATGAGATGATCAAGGCTGGT
CGCCTTGACCGCCGCTACGATGGCATTGCGGACTGCTTCCGCCGCACCACAGCCGATGAGGGTGTCATGTCCCTGTGGCG
TGGTAACACTGCCAACGTCATCCGGTACTTCCCTACCCAGGCGCTGAACTTCGCTTTCCGCGACCGCTTCAAGAAGCTGT
TCGGCTACAAGAAGGAGCGTGATGGCTATGCCATGTGGATGATGGGCAACTTGGCGTCTGGTGGTGTACGTACTTTGTCC
CCAAGCTCTGCACTCGTTTGAGTACTCTTTGCTGACAATCTCTACAGGCTGCCGGTGCCACTTCGCTGCTGTTCGTCTAC
TCCCTGGACTATGCCCGTACCCGTCTGGCCAACGACGCCAAGTCTGCCAAGAAGGGTGGCGAGCGCCAGTTCAACGGCCT
GGTGGATGTCTACCGCAAGACTCTGGCCTCTGACGGTGTTGCTGGTCTGTACCGTGGTTTCGGTCCCTCTGTCCTGGGTA
TTGTTGTCTACCGTGGTCTGTACTTCGGTCTGTACGACTCCATCAAGCCCGTCGTCCTGGTCGGCAACCTCTCGAACAAC
TTCCTGGCTTCCTTCCTTCTGGGTTGGTGCGTCACCACTGGTGCCGGTATCGCCTCGTACCCGCTTGACACCGTTCGTCG
CCGCATGATGATGACCTCTGGCGAGGCCGTCAAGTACAGCAGCTCCCTGGATGCCTTCAGACAGATTGTCGCCAAGGAGG
GCACCAAGTCTCTGTTCAAGGGTGCGGGTGCCAACATTCTCCGTGGTGTGGCTGGTGCTGGTGTGCTGTCGATCTACGAC
CAGCTCCAGGTCATTGTCTTCGGCAAGGCCTTCAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62