GenePrediction:GLEAN_6890 Details

Name: GLEAN_6890
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1082801..1082129 (- strand)
Length: 673
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1082801..1082286 (- strand)
Length: 516
Type: CDS
Source: GLEAN
Position: GCSC_108:1082176..1082129 (- strand)
Length: 48
>GLEAN_6890 class=GenePrediction position=GCSC_108:1082801..1082129 (- strand)
ATGCCGCCCCAGATCGCGGCCGCACGGCCATCTACTGCCGCAAACGGACGACCCTCTTTCAAGGCAGCAGGATCGGGCGC
ACGAGCCGGCGGGCAGCCAACCTTCAAGCCGCCGCGGCCAAAGCCTCAACCCCAGAAAGAGACAAGAGAACAAAGCAAAC
AGAAGGGCAAGCGGCCACAGGAGCGCATAGATGTAGACGAAGATGTGGTCGATTTGGAGGACGAGGAGGCGGAGTCTTCC
CGACGTCGTGGGAAGAGGCGAGAGGTTTCTGGCGCTGCTGATGATTTAGCGGCGCTTGATGACATGGAGGACGACGAGGC
CGATGATGGTGACGACAGTGAGACCCCCTCTATCCCACCGGAGCTGCTCACTCGCCTGCTGCATCACTTCTTTTCGAAGC
CGAACTCGCGCATCACGCAGGATGCCAACACGAGCGTTGGAAAATACATGGAGATATTCATACGGGAAGCGGTGGCCCGA
TCCATGGCAGAGCGACGCGATGGCAGTTTCCTGGATGTGCGTTTTTCCAATCTCTCTATAGTCCCGTTTTGTCATGCCAG
AGCCTCGTTTTTGCCTCGTATTGACCATACTCTATCCCCCATGCTTACTTTCGCTCAATTCGCAGGTCGACGTGTTGCAA
AAGGTAGCAGCACAGCTCATTATGGACATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62