GenePrediction:GLEAN_6891 Details

Name: GLEAN_6891
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1078389..1076739 (- strand)
Length: 1651
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1078389..1077957 (- strand)
Length: 433
Type: CDS
Source: GLEAN
Position: GCSC_108:1077889..1076739 (- strand)
Length: 1151
>GLEAN_6891 class=GenePrediction position=GCSC_108:1078389..1076739 (- strand)
ATGAGCAACCCCACGCCCGAGAAGAGAGCGAACGAGGGGAGATCCGCTGCGACCCCAGAATACTACCCTCCTCCGCCAGG
CCCACCGCCGAATCAGACGTCTGCACAACATCCAGACGAACAGCCGCTTCCAGACTACACGATTCCAACATACATTCCGT
CGAGCCCCAGCTATGCACATGCGCCGGCGCCGGTGCCGTCAGCTCAGCATGGCCAGGCGTTTGGAGGCACGGCAGTGCAC
GACGACCATTCGGGCCACCACGGCTCGTCGAACGGCTCCAAGCCTGACCTGGCCGACCGTCTGTCGGCTTTGGGAGCGAA
GGCGTCGTCACCCATCAACATGCTTGCCAACAAGCTGGGCTCGGAGGGTTTTCTTCCGGCGTCGATGGACAAGGAGTGCG
AGAAAGCGGCGAGGATATTGAGGGGATTTTGCAGTACGTTTTGGGTGGCGGTCTGCTTCGCGATTTGGTGGCTACTGTTG
CTGACATATTCTTTATCTAGAGGACGGAATCTACGCCGACACCGAGAAGACGCAGTCGTCGACGGATGAGGCGGCGGGCA
AGGGCAAGCAGAAGCAGAAGCAGGTGTCGCGGGCGATCATCACGATTCCGGCCAAGGTGTTGCAGCGCGCCGTGGGCCTG
GCCGTGTTCACGACGGGCCGCGTGGGATTCCACGTGTCGGGTGCGACGGGCTCTGGTGTGCTGGTTGCGCGTCAGTCGGA
CGGTGGCTGGTCGCCGCCGTCGGGCATCCAGATTCACTCGCTGGGCGCGGGCTTTGTGTACGGCGCCGACATCTACGACT
GCGTACTCGTGATCAACACGGAGGAGGCGCTGAACGCGTTTCGCAACACGCGACTGTCTCTCGGGACGGACCTGGCGGTC
GTCGCTGGTCCCTGGGGTGCGGGTGGCAGCCTCGACATCGCGGCGCCCAAAAGCAGCAGCAGGTCGAGCCAGAGCAGGCC
TGGCAGTGCCGAGAGTGGCGGCGGCGGTAGCGGCGGCGCCGGCTTGCAGCCCACGAGCACGACACAGACGTCGGGTGGCA
GTCCGGGCAAGAAGCCGTCAAAGCTGCGCAGCGCCGCATCCAACGCGGTCTACTCGTACATCAAGTCGCGCGGCGTGTAT
GCGGGCGTGCAGGTCGACGGCACCGTGATTGTCGAGCGGAACCAGGCCAACACGGCTTTCTACGGGGCTCGTGTGCCGGC
GACGCGAATTCTCCGCGGCGAGGTGCCGGCCGGCAGCTGGATCAAGTCCGCGGCGGTGCTCATGGACACGATCCGGGGTG
CCGAGGGTCGTGCCGCCGCAGGTCGGCCGCCCCAGGCAGAGCCAGCACCGGGGCAATGGCAAGGGCAGCAACAGCAGCAA
CAGCAGCAACAGCAGCAACAGGGACAACAACAGCAGGGACAACAACAGCAAGGACAGCAACAGCAAGGACAATCCCAGGC
ACAAACATATCCCAAGACGTCGACAGCCTCACAGAACTCGGAGACATGGGCGAATGCGGCCCCAGCAACAATTGTGATGC
CGAGGGCGGGACCGCTGCCACCACAGTATTCGGCCGAGGCAGAAAGCAACACCGAACATGATCTGCCACCAGCATACGAG
GAGCCTGGCCATGCTTTCCCCGGCGTGGGCGATAGCAAGACGACGCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62