GenePrediction:GLEAN_6893 Details

Name: GLEAN_6893
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1069404..1066480 (- strand)
Length: 2925
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1069404..1069195 (- strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_108:1069133..1069092 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_108:1069026..1068921 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_108:1068790..1068257 (- strand)
Length: 534
Type: CDS
Source: GLEAN
Position: GCSC_108:1068191..1068119 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_108:1068064..1068015 (- strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_108:1067542..1067340 (- strand)
Length: 203
Type: CDS
Source: GLEAN
Position: GCSC_108:1066593..1066480 (- strand)
Length: 114
>GLEAN_6893 class=GenePrediction position=GCSC_108:1069404..1066480 (- strand)
ATGGATCCCGATGGCGAGCACCACGCGTGGCCAACTACGGACGAGTCCAGCGACGACGGCCACGACGACCGGCTTGGGTG
GATGGCCAGAAACGCCGCCATGCCGCCTGTCCTCCCAGCTACTTCCGTGCCCGACCTGGACGGCTGGATTGAGACGCTGA
GGAGCTGCCGCCCGCTGGCCGAGGCCGACGTCGAGCGGCTGTGCGAACGGGTGCGTGTTTGTGGTGGTGGTCTCCGTCGC
GCACATGGGACACCCAGGCTGACTCTTGCAGGCTCAACTCGTGCTGGCAGGCGAGTCCAACGTACAGCCAGTGGTGAGTT
AGTTTGGTCTCGTGGCCTTGGACAGCCACTCGGCCAACTGCCAGCTGACAGCCTCCAGGCAAGCCCGGTGACCATCTGCG
GCGACATCCACGGCCAGTTCCACGACCTGATGGAGCTCTTCCGCATGGCCGGGCCGTGTCCGGACACCAACTTTCTCTTC
ATGGGTGGGTGAAGGAGCACCCGCACCGGTGGACTGCTAGGAGAGAATCACGCCTTCTAACCAACACGTGTCTCTGTCGC
CCTGTCGCCCCTCCCCGGCTCTGCGTCTCTCCGTTTCGCTCCCCCTCTGTTCAGGCGATTATGTCGACCGTGGCTACCAT
TCGGTCGAGACCGTCAGCCTGCTGCTGGCCCTCAAAGTGCGCTTTCCGCGCCGCATCACCATTTTACGTGGCAACCACGA
GTCGCGCCAGATCACCCAGGTCTACGGTTTCTACGACGAGTGCCTGCGTAAGTACGGCAACCCGCGTGTCTGGGCTTGTC
TGACCGACCTGTTCGACTACCTACCCGTGACCGCCCTGGTCGACGGCCAGGTCTTTTGCCTGCATGGCGGCCTCTCGCCC
AGCATCGACTCGCTCGACCATGTCCGCGCCCTCGACCGCCTGCAGGAGGTCCCCCATGAGGGCCCCATGTGTGACCTGCT
CTGGTCCGACCCCGACGACGCCCCCGGCTGGGGCATGTCCGCCCGCGGCGCCGGCTACATCTTCGGCCCCGACATCTCTG
CTGCCTTCAACCACCACAACGGCCTCGATTTTGTCGCCCGCGCCCACCAGATGGTCATGACCGGCTTCGAGTGGACCCAC
GACCGCAACGTCATCACCATCTTTTCCGGTACCGTCTTAGTCTTTGCATCTGCCTCCTGACCTGCTTTAACTCTCTGTGC
TGACTCGTCACAGCTCCCAACTACTGCTACCGCTGCGGCAACCAGGCCGCCATCATGGAGATCAACGAACACCTGGATAA
TGAGCTGTGTGTTGCGATTTTCACTCCCTCAGCCCTCTTTCGATCCTGACATCCTCGCAGCCTCCAGTTTGACCCGTCTC
CTCGGGTTGACATACCCTCACAGCCAAAGCGTCAGTGCCATTTGCTGCTACCCCAATTAAAACTGCTCTTTTCTGACCGT
CTATCAGGAACCCCCGATTATTTCCTTTAAGGCTGGCTGGATAAGGAAAAGGGCACTGGTCGGGACAGAGACTTTCTTCA
AACGTTGGCTTATTCTAGGCACGAAGATGGCAACCGACCAGTACTTAGCTTGACAACCTGCGGTCACCTGAACTCTTTTA
TCAGCGAATCATACATACTTGGAGCTTGTACTCCGTAAGCCAATGTGATTGACGTAGACAAAGTCGGATCCACAACGGTC
CGACGAGTGTCAGCTTGAAAAATAGTGATATTTCTGAACGCCATGTGGCCTGACATGCCTGATCGTTTGACGTCCTTATA
CGCCTTATACTTCGGCAATGTCTTTGTGTGCGACTTGCGAGAGCATAGACTTTCGCGTCCTCATCAATGTCTGCATTCGA
CAATGCTACGTTAGACAAGCAGATATCGAGATCGATGGTGCCTCGTTCAAGTCGCTTCTAACGGCCACGATGAAGCACCA
TAAGGATATCTTTGCGATCAGAGATTCTGGCGAGAATTACGGTCTTTGCAAAGTTATATACAAAGAATTCGAGAAGAGAA
ACGTCGATCCAGAAGAGGCAAGAGACCTACCGATCTTCTTCCGTGCATTAGACAACAGAATCGAAGTGTGCTGTGAAATT
GATAGCAGTCTATCCAGTCTATGTCATCTGGATACATACATGAACGATGATGATGGTGTGTAGTTCCTTGTAAAGTGTAT
GAATACGACTAACACTATTGTAATGGAGGAAGTTTCTCAACAATGCAAGATAACCGATTCTAAAAAAGAGTGAGGAAGAT
CCCAGCTCAAAGACGTCTTTTGCGGTTGCCTCTGGTTGGTTGAGAAAGTGCATAGGTAGCCACGGTCTTTGCAACCCACC
AAAAAGATTCCAGAAGCCACCGAAGCGGTTGATCGACGTTGGCAACGGAGCCCAGAACCCAGTTTTGGTGGAAACCTCTT
TGGGCTCTCGACAGGAAAAATGGGTAGCTCTAAGCTACTGCTGGGGGAAGGAGCCCTCGTTGAAGCTTACCGCAGACACC
ATGGCCATGATGAAGAGTGGCATCCCGCTGCACAAGTTAGATCCTTTGATCCAAGATGCCGTAACGGCCACCAGAGCTTT
GGAAAGCACCTACATCTGGATCGATGCATTGTGCATAATCCAAGAGGATAACGGCGAAGACTGGAACAAACAGGCGTCTA
AGATGGACGAGATATACGGAGGATCGACGGTGACTCTTGTTGTCGCGGACTCAAACTCTGTCAAGGCCGGATTTTTAGGC
AAACGAGAAATGAAATATATTCCCATTGCGCTGTCTAGAAAGCCAGGTGGAAACGCTTCCGTGATTAAATCTCCAAAGGT
GTTCTTGTCAGCCGGATGGGATGAGAACAACGACGAGCCACATGGACCCTGGAATCACCGAGGGTGGACAATGCAAGAAG
GCCTACTTCCCAATCGGCTACTGCATTACACCTCTTCTCAGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62