GenePrediction:GLEAN_6894 Details

Name: GLEAN_6894
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1049154..1047302 (- strand)
Length: 1853
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1049154..1048468 (- strand)
Length: 687
Type: CDS
Source: GLEAN
Position: GCSC_108:1048293..1048163 (- strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_108:1048100..1047523 (- strand)
Length: 578
Type: CDS
Source: GLEAN
Position: GCSC_108:1047471..1047302 (- strand)
Length: 170
>GLEAN_6894 class=GenePrediction position=GCSC_108:1049154..1047302 (- strand)
ATGTCCGTGGCCATTCCCCAAGATCATGCCGGGTATGACGACTCCCTTGCATTCCGAGATCGCTACAGACACCCTGGCCA
CGAGGACCGGCTGGAGCCCAAGGACGGCGATGACGACCACAAGCATGCGAGTGAGGATCTGTCCCGCACCGACGGCGTGT
CGGCTGACCAGGAGCTTGAGGCCTTTGGCTACACGCCTGAGCTCGCTCGCAGTCGATCGACGCTGCAGGTGGCCTTCATG
TCCTTTGTCTTGGCCGCCATTCCCTACGGCCTCGCGACCACATTCTTCTATCCGCTCGTTGGCGGCGGTGCCACCAACAT
CATCTGGGGCTGGGTTGGCGTCTCGGCCATCATCCTCTGCGTGGCCGCGTCGCTTGGCGAGATCACCAGCGTCTACCCGA
CCTCGGGCGGCGTCTACTACCAGACCTTTATGCTCGCACCGCTGCGCTGGCGCCGCGTCGCCAGCTGGATCTGCGGCTGG
CTCTACGTCGTCGGCAACATCACCATCACGCTGTCGGTCAACTTTGGCACCGCCCTCTTCCTTGTCTCTTGCATCAACGT
CTTCGAGACCGACGGCGTCGGCATCTTTCCCGGCGAGCCCTACCAGGTCTTTCTCGTCTTCCTTGGCATCACTATCCTGT
CCGTCCTCGTCTCGTCTCTAGGAAATCGCTGGCTTCCCATTTTGGATGTAGGAAACACACTCTTTTATTCTTCTGCTTCG
CTGCTCCACGTGTCGTGTATGAGTGTGTGCGTGTGTGTGCATGTGTATGTGAATGCTTACATAATCCCATAGACTGCTGC
CATATTCTGGACCTTTGCCGGCGTCATCGCCATGGTTGTTTGCATTCTCGTCATGGCCAAGAACGGGCGCCGCAGCGCAA
AATACGTCTTTACCAGCTTTGAGCCGCGCTCTGGTTGGGTTCCAGGCTGGTCTTTCTGCGTGGGTCTGCTGCAGGCGGCA
TATGCGACGTCCTCGAGTGGCATGATTATCTCGTAAGGCCCTTCTACTGCCTGTGTTGGCGCCTCTTTTCTAACCGGTGT
TGTGATTGGATCAGAATGTGCGAAGAAGTCCAGCAGCCGGCCACACAGGTCCCCAAGGCCATGGTGGGCACCATTGTGCT
CAACACGCTGTGCGGCCTCCTCTTCCTGATTCCGGTGGTCTTTGTGCTGCCGGACATCGACGAGCTGGTCGCGCTGGCTT
CGGGACAGCCGTTTCCGAGCATCATCAAGTCGGCCGTGGGTTCTCCTGGTGGTGCCTTTGGCCTCCTGGTCCCGCTGCTC
GTCCTGGCCCTCATCTGCGGCATCGGCTGCACGACTGCGGCGTCTCGGTCGACCTGGGCTTTTTCCCGCGACGGTGCCAT
CCCTGCGAGCCACCTCTGGAAGAAGATCGACACAAAGCTGGACGTGCCGATGAACTCCATGCTGCTGAACACAGGTGTTC
AGATCGTACTCGGCGCCATCTACTTTGGCTCGACCGCCGCCTTCAACGCCTTCTCCAGTGTCGGCGTCATCTGTCTCACC
ACGTCCTATGCTGCCCCGATCGCTGTGAGTCTGATAGGAGGCCGGCGGGCCGTTAAGACGGGCAGCTTCTACCTCGGCCC
AATGGGGCTCGTATGCAACGTCATTGCGCTCGGTACGTCGTCCTCGAACATGAATGCCAATTCAGTTGCTAACTAATGGA
CAGCCTGGTCGCTGCTTGCAATTCCGCTCTTCTGCATGCCGTCGACCCTGCCAGTCGCAGCGACTACTATGAATTACGCC
TCTGTCGTGTTTGCAGCCTTTGTGCTCATCTCGGTTGGATGGTATGCTGTCTGGGGCCACAGCAACTACACTGGTCCCCC
AGAAGCACATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62