GenePrediction:GLEAN_6895 Details

Name: GLEAN_6895
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1046708..1045308 (- strand)
Length: 1401
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1046708..1046547 (- strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_108:1046494..1046310 (- strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_108:1046255..1046189 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_108:1046135..1046095 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_108:1046039..1045950 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_108:1045890..1045308 (- strand)
Length: 583
>GLEAN_6895 class=GenePrediction position=GCSC_108:1046708..1045308 (- strand)
ATGGAGGAAGAAACAAGCACTGCACCGGAGGCATCCCCGGTAACCAGAATTGAGGCAACGCCTGCTCAGCCGGCTGTCAA
TGAGGCGACTACTGTACCGCCGGTCGCCCAGGCGGCATCGACTGTACTGCCGGCCAATCACTGGGTACAACAGGACGAGG
AGGTAAGCATTGCCTGATCAGCGGGACAACGCAAATACACAACTGACCGACCAGAACCCGGTGGACACTGACGCGGACTC
GACTTACTCCATTAGCGACGAGCTAAGCTCCACAGCTTCCATCACGTCAAGCATCTTGCGCTACCGTGAGATCAACGGCA
GGACGTACCATGCTGAACAAGGCGATGTGCAGTACTGGGCATCGAATGACGAGACCCAGAGCGAGTCAATGGACATCAAG
TAGGCTTCTCTTTGCCGTCAGCTGTGCATGACCGGCCTTGCTGACAGGATCAGTCACCACGTCCTCTTGCTGAGCACGAA
CAACAAGCTGTACTTTGCACCCCTGAAAGATGATGTCCATGTGCGTTGAAGCGGGACAGAGGAGCATTGTGAGAGCCGCA
GCTGACAAGATAGAGAGTGCTGGACATTGGAACCGGAACGGGCATGTGGGCAATGTACGTGGACCTGACGGGTCCTTTTC
ATCGTACCTTGAGCTGACCGACGAATCAGAGACTTTGCCGACGACCATCCTGGTGCTGAGGTGATTGGAACGGACATCTC
GCCGATCCAGCCAATTTGGGTGCCTCCGAATACAAAATTGTGAGCAGCGGTTTTTTGTCTTTTCCTCTCCTCCTCTCCTC
AATCGCTCACAAGTTCAGTGAACTTGAGGACTTCACACAGCCGTGGACGTTTCCGGAGAACTCGTTCGACTATGTGCATA
TGCGCTGGCTCTACGGCTCGGTGCCGGACTGGACTAAGTTGATTCGCGAGGCGTATCGCGTGCTCAAGCCGGGCGGCTGG
ATCGAGAGCTCCGAGGCCACGCCGCTGGTCGAGAGCGACGACAACTCGGTCCTGCCCGGCAGCGCTATGCACGAGTGGGG
CAAGCTCTTCCTCGAGGGCGGCGACCTGCTCGGCCGCACCTTTCGCATCATCGAGAAGGACCTCCAGCGCAAGGGCATGC
AGGAGGCCGGCTTCGACGAGGCGTCCATCGGACAGTGGGACTTTAAGTGTCCCGTCGGCGGCTGGTCCGACGACCCGCAT
CTCAAGCAGATCGGCCAGTACGTGCAGCTGACGGTGGAGTCGGACATTTCCGGCTACGTCGGCTTCATCGGCAAGCTCGT
CGCCGGCTGGTCCGAGACCGAAGTGGCCATCTATTCGGCACAGCTGCGGCGCGACATGCGTTCGGGCAAGCACGCTTACT
ACAGGCAGCGTGTGGTCTGGGCACAGAAGCCATTGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62