GenePrediction:GLEAN_6896 Details

Name: GLEAN_6896
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1042813..1041776 (- strand)
Length: 1038
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1042813..1042699 (- strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_108:1042638..1042435 (- strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_108:1042380..1042150 (- strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_108:1042086..1041963 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_108:1041911..1041776 (- strand)
Length: 136
>GLEAN_6896 class=GenePrediction position=GCSC_108:1042813..1041776 (- strand)
ATGCTGGCCGGTCAGACTGCCATAATCACGGGTGCTGCCCAAGGCATCGGAGCCGAGACGGCCACCATCTTTGCGCGTGA
GGGTTGCCGGGTTGTCATCGCGGACATCGATGCCGGTATGGCCTGATCATTGTGATGTGGCACAAAATGGGACTGCTAGC
TGATACCGATACCAGACAAGGCCGAGGCCACGGCACAGGCCATCATCTCCGAGGGCGGTTCTGCGCTTGCGGTCGGCGGA
GACATCACGGACAACGAGGCTATCGGCAAGCTGGTCCAGAAGGCGGCCGAGTTTGGCGGCGGCAAGATTCACATCATCGT
CAACAATGCAGGCTACGCCTGGGATGATCCGATCGAGAAGATCCAGGACAAGCAGTGGGGTGAGTCGACCTGGTGGGCAA
GTTTGTGTTTCGTGTCTCCGTCCTGACAAGCAGACACCATCATCGGCCTCCACAACACGGCGCCATTCAAGATCATCCGG
GCAGCGGCTCCATACTTTATGGTGAAAGATGGCGAGCCGAGATCGATCGTGAACATCTCGTCGACGTCGGGGATCTACGG
AAATGCCGGACAGGCCAGCTATGCTCTGGCCAAGGCAGGGCTCGTCGGGCTGACCAAGACGGTAGCGCAGGAATGGGGGC
CAGAGTACGGTGTCCGTGCTAACAGTACGTTTGCGTGGCTGCTGCTCGGACTCGGAATATGAACGTGTGGACTAACTGTC
TGTCCAGCCGTCGCATTCGGAGCGGTCAAGACGAGACTTACACAGGCTCCCAAGGGCGAGTTTGTCGTACGGCCCGACGG
CACAAAGCATGCGGTTGGATTCTATGGTGGCTATGACGAGGAAGAGAAATGGTAAGTCGAATGTGGATTCGCAAGGACTT
CCCGTACTGATAATGCCGATAGGGTTGGAGACATACCTCTAAGGCGAATAGGAACACCCACAGACGCTGGGAGGGCTATC
TTGGGCGTGGTATCGCCGCTCTTTCAGTATGTCACCGGACAGACGATTATGGTCAGCGGCGGTAGGGGGGGGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62