GenePrediction:GLEAN_6897 Details

Name: GLEAN_6897
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1038666..1036183 (- strand)
Length: 2484
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1038666..1038568 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_108:1038500..1038406 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_108:1038338..1037485 (- strand)
Length: 854
Type: CDS
Source: GLEAN
Position: GCSC_108:1037423..1036183 (- strand)
Length: 1241
>GLEAN_6897 class=GenePrediction position=GCSC_108:1038666..1036183 (- strand)
ATGGTGGAGCGACACAAGGATTCGTCTGCTGTAGCCGGTGCCGCCCCGGTCCAGCGAGCCGCCATTGCTTGCCGCAGCTG
TCGGCAACGCAAGGTCAAGGTAGGTGGCCACATCTCCGTCTCCATCTCCGTCTCCGTCATGGTCCTTGCTGACTGATCCT
CTGCAGTGCGATGCCCAGCCCGACCGGCCCGACCAAAGTTGTGGTCCGTGTCGACGCGCCGGCAAGGACTGTATGCTCGA
CCCCATGTCGGACGGAAGAAGGTTTGTCATACCCTGCCCCGTCGTCGTGTCGGCGTCCGATCCGGTCACGGCTGCTGACT
GGCCACAGATCCGTCAACCGCAAGTGTGTGGACAGGCTGCAGCAGCGCATCGAGATGCTCGAAGCCCAGAGCCAGAGAGC
GGCTGATCGGGTCGGCTGGGACTCCGGCGAGGACAGCATCCACCATCATCCCGTCCGTCCGGCTGCTGCAGAATACACGG
CCATGCTGCTGTCACAGGGTCCGACGTACGTACACTCAGCGAATGCAAACCCGGATACGACCGCTTTGGCTGACATCCCA
CCAAGAAGCACACAGTCCACAAACACAACCGACACGGTATCACAGCCATCGCTGCCTCCTCCTCCGGCCCGTGTCGAGCC
AGCGCCAACCTCCTCCGTCAGCGGAAGCTCACCGGGGGCCAACAGCAGCAGCCATGGGTCCCCGAGCTTCTACGGCGCCA
CGTCGCACCCCCACGTCGGCACGTCCAACGAGGAGGCACCAATGCCAATGCCGCTCTTTGATGAGGCAGACGTGGCCGGC
ATCGGCATCGACCTCGACCCCAACTCGCCGCACCTGCGCGCCCATCTATTCCAGTCCTTCTTCCAGTACCAGACCCTCTG
GGTCGACGTGGTGGACAAAGAGGCGTTTCTGGGCCAGCCGACAGCCGGTGGCGGCATTGGCGGCGCCAACACCCAGTCCC
GGTGGCGGTCTAGCTTCCTAGAGAATGCCATGCTGGCGTGCGGCACCCGGCTCAGCACGTCCAAGTCGGTACGCGCCCTA
GGGCCCAAATACTGTGAGTGGGCCAAGGGCGACGTTCTGCGGGCCATGTCCGACCCGACCCCTGCGAGCTTGCAGGGCTT
TCTGCTGTTGAGCGAGTACGAAGTCACGCAGGGCAACGATCGGCCAGCCTGGATGTACTGTGGTGAGTCTGTCTCTTTCC
GTCTCTCTTCGGTCTTCTGTGTGGGGTGGTGCTGACTAAGCAGGCGTGGCCTGCCGGATGTTGTCGGACCTGGGCCTGCA
CGAGCTGGCGAGCCTGGCAGACGGTGCGGGCGAGGATGCCGAGGCGGAGCGGGAGGACGACCTGGCGTACGCGCTGCTGT
CGGCCTGTGTGGTATACGAGGGCGTCTGGACGTTGTATCTGGGGCGGCCGAGCTCGATCCCGCGGGCGGTGATGAGCGTG
GCGGCAGCGCGGTGTCGGCAGCGACGACGGGCGGACACGCCATGGCTGAACGCATGGGTAGGTCTCAGCGTGCCGATGGC
CGAGATCACGCGGCTGCTCAACGAGCGCTGGTGCGTTGCCGGCGACCTGGACGGCGACCGGCTCGCGGCCCTCCGAAGAC
TCTCGCGCCAGGTAGACGACTGGTATGAGGGTCTGCCACCAGAGCTGGCCTACGTCGAGGACCGGCTGATCAACATGCAC
CTGGCCGGCTACGGGCTGCATGCACAGTACTGCAAGGTCCAGATCTTGGTGCGGCAGGCGCTGGCTCAACGGCAGCAGCC
GTTCACGACGACAACGACAACAACGAGCACGGCAGCAAGCACGATGAATCCCCGGAAGCGACCACACGCCCAGATGGAGG
AGGGCGGTGTAGGAGCGGCAACAGCCGGCCCGGACGACGCTTCCGAGGCCGTGGCCTACCAGTTTGCCCTCCGCATCGCC
CGGCTGGTCGTGACGTATCGCGAGGCCTTTGGCATGGAGCAGATCCCGTCCATCATGCTGGACAACTCGGTCGTCGCGGC
CACGGCCATGATCCGACACCACAATGGCAGCAGCAGCAGCAGCTCGACCGAAGGCGCCGGCGAGCTCGTCTGGCTGCGAC
AGCTCATCAAGAGCATGGAGTCGGTGCAGCCACACTTTCCCATCATCGCGCGCATGCTCGACTCGCTCAAGCAGATCTGT
GGCAGCGGCCCACTCCTCCAACTGCTGCCGGCTGCCCGTCGGGGCTCGAGCGAGTCCCGGGCGCTCGACTCGCTCGACTT
TGGCGCCATGAACAGCAGACAGAACAAGAACGGCAGCATCAGCAACTACTACGGTGGCGGCAGAATCGACAGTACGAATG
ACAGCTCCATCGGCCTCGGAGGCGGTTCTGATCTCATGTGGGACTGCTTTGATGCCGTCATTACGCCGAGCATCTTCCAG
TCGGGTGCCTTTGTCGACTCTGACCTCGACCTCCCTCCGCCATCCGAGGCTCTGAGCTCAGCCCTCGCCCAGGTGGTGTC
GTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62