GenePrediction:GLEAN_689 Details

Name: GLEAN_689
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1451895..1456145 (+ strand)
Length: 4251
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1451895..1452094 (+ strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_97:1455032..1455180 (+ strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_97:1455234..1455806 (+ strand)
Length: 573
Type: CDS
Source: GLEAN
Position: GCSC_97:1455881..1455986 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_97:1456046..1456145 (+ strand)
Length: 100
>GLEAN_689 class=GenePrediction position=GCSC_97:1451895..1456145 (+ strand)
ATGGGCGTCACCAAGACTATGTACCAGGAAGGTAGCGGCGTCAACTCAATCCAAGGCCAGCGCGTCATCATTAAGTACAC
CGGCTTTCTAAAGGACTCTCCTGAACCCGACAATAAGGGCGAGATTTTGGAAGCACTGTCGACCGTGGCGACTTTGTCAA
AACTATCGGCGTCAGCCAAGTCATTCGGGGCTGGGATAGGGTATTTTACAGATGAAGGTCGTTGAGAAGGCTGCCCCGGA
CATCTCGAGTGACTTTGGCTACGGCACACGGTGCTATTTTGCGGACAAAATCCCGCCAACTTTGACCTTATATATGATAT
CCGTTTAAAGAAGATTCAGTAAGGGCAGCACCCTCTCTCCTGGCTGAAATCTGGGCACATAGACAGACGGGAAACTGCAG
CATTTCATGCTAACGTCACCCCAGGAGCATCTATTCTGATTTTGGGGAAAATTCAGAGGCTTTTTGAAAGACAACCCCGA
CGACAACAGGCTGCAAACCATCACCAGTAGTATGCTGTGAAAGTTGATTGTTTTTACACATGTGCAGTTTCTGAAGTAAA
AAAAGGGAGAGGTGCTAGGGCAGTCATGACGTCTACGCTTACTAACAAGAGATAAAGGCATTCGACGCAGTACACATTCA
TGTAGAAGTGAACTGGCGACCGGGACCCGGACAGGGCCAAGGGGAGAATGATCAGAACAGAAACAAGCACAGAGAAGAAA
AAGGTGCTGGCGCTTAGGGTTTTTACAACATGGCGCAGAGCATGGCGAGAGAGAAATCCTGAAAGTCTGTTGTAAACAGA
GGAACAATTACAAGAAGTTATGTTTCATTCTCCTTTACGCCGTTTATGCTATGCGCATTTTAATCCATCACCCAGAATTT
GCAACCTGCGGTTTAAAAATCCCCTTATTTCAACCATAGAGGGTAGCTATTCACAAGTTCGTATGCTTCAATATCGTTGA
TATAGACAAGTTTCTATCTCAGAACAATGAAACGGCTTGCATTCAGGTTGGAGTCAATCAACCATTATAAAGATAAATTA
TAGGGACCATGAAATAACAGCATCTAGGTATTGCATAAAGCATCTGCATCTTCAAACAACTCTTATTTACTAAGAGGAGA
AGAGTTGCTGTAGGACTCCCTCACCGCCGAGTTCCTAGTAGTCGGTCAATCTTCCCTTGCAGCTTGCCTTGCCAACACCA
ATCTCAAAGGGCCTCGTGCTTGAAACTATTTTTTAATAGGTGTAATTTTGCGACGAGCTTCTCTCAATGTACCCCACTAG
CTCTGTCCTCTCCTCACCTACTCCTCGACAATGTTTCCGCCTCCCTCAACCAGCAGGACTTCTAGATCTTAACTTCACCA
AAGGCTAAGCGATAAAGGTTACGATCTCGTCGATTGAGATGTCACGGAACAAAACCACACACTAATTATACCACCAGACT
TCTAAAGTCAAAGTTCCCATGTTTTGACCAGTATGCTCACTTTAGCTTCATACTGGGTCTGGCCTTTAATGTGCAGCAAT
GAGAATACTGTCATAGGTATCACTAATGGAAATTTGAAATCTTTCAATTGCATCGTAATACAAGCTGGTTGCAAAACCCA
AAATGGCTATATGTAACCCTTTTTACATTTCAAAAGGAAACAATCTAAAACAACATACGGAGTATATAAGAGACAAAAAG
AAACAATGGAGCAACTCGGGATCGAACCGAGGACCTCCAGCTCTTCAGGCTGGCGCTCTCCCATCTGAGCTATTACTCCG
GATATAAGGATTTCCTTAATCGGAAGGTTTCTATAGCCGAGGCTCTGGCAGCTCATAACGAAGTGATTGGACTCTGCTTG
TAAATAGTCTTTTTTGATAAGTGCATGTCACATTGTAGTAATGTTTCTGTCAACTGGGTTCCAGGTGATGTTGTGTCTGT
CAGGAGACTGCTAACCCAGCTCAAATGAATATGAAGACTGGGTCCTAAGACGGCTTGAAAACTGTCTTTCTTCTTTTCGT
AGATCCGCTTTCTATATCAGCAATTAAACCTGGATGTTCCGGCACCCTTTCCAGCTCCTGACGTATCACAAAGCTTGATG
TTTGGTTGTCAATGGAAGCCGGCGTTGGAAGGAAGTCGAAGTGATCCGGGTCTCTTCGACCAACGCTTTGATAACATGAA
TATGCATCACCTTTCCAATCCAATTACAATGGCCTTCTGAGAAACGCCAAAAAATCATGGCAATAAGCCTTTATCTTCGT
TTTCATGGTTGGTAGGAGCTAGACGGACGACCATTGCGCGCCCCTTTTGTGACGAGGTCCTGTGTAAGCTCTGACTTTGC
ACGGGTCCTGTTTGATAAGGGATCGCCCAAGTTAATGGGATCGCCCTCAAGTCCCAACACGACCTTAGGAGAAAAGGAGT
ATGCTAGGCCCAGGACACTATGGCCAGCCTCGAGCAGGTCCTTAGGGCCCGGCCGATGAGGCTTGATGCACCGACAACGA
AAACTCGTATGCTCGACGATATGGTCTCTGGAAGAAAGAGATAATATGAATTTTTAGCGGACAACTAGTCAATCAGTAAT
ATATGCGAGAGCGGGTTAGCGCGTGTGACCTGAGGGAGTGTTCCAAGACGTCGATTTCAACTTTGTGGGCTGCAATCAGC
CCTTACGAATCAGACTGGCTTGGATGTGTGTCAAACTTCCAATATTTATCCTCCGTGGCAACCCGCACTAGAAGTATATG
GCCAAGCAGCTTGACCAGCATTGATGCCGTTCTTGCCAAAGGTAGTATATGCAGATGACGAGTCTGGCGATATTTCTATA
GCGGGGTCTAGATTTGGACCCACCCAATTTCTTTCTCACTGGAGTTGTGAGAGAAGAGGAACAGGATCCTGCATTCAATC
GGCTGCTCAGGGCGTGGACCAAGCCGAACTCCAGTCACGATGAATCCGATGCTGCCTCCACGGCTATGGCAGCCAGTGGG
CCGACAAATTATGGCGACTGCTGCTGCGAAAGCTGCAGCACCTCGGACAGCTGTAGGTCGTCGCAGTCTCGCCACGAACT
CCACCACGACCACCACGACCACCACGGGCTGCTGCCGCTGTCTGCATCGACCGGTGGGTGGACGCCGCCTAGGTGGACGT
GTCTCTCTGTTCTCCAGCTCTGCGGCTGGACAGCGGCCGTCACGGCCACAGGAGCCGGCCGAGGCGCCACAGCCGGCGGA
CGACCCCAACTTCTCGTCCATCCTCGACAACCCACCCGAGCTGGTTCGGTCGGGGCGGCGACACGGACCGGGCATTCTTA
TTTTGGGTACCCTTCCTTGGGCGGACTCCCCGACGAGGTGCACCCCCGCTAACCGGCAGTGCTCATCCCCGTGGCCGCCT
TTGCCCTCGGCACCTGGCAGGTCTTCCGGCTGCGCTGGAAGACGGACATGCTGGCCAAGTGCGAGGACCGGCTGGTGCGG
CCGCCGTTGCCGCTGGGGCTTAACAACGTGGCCGATGCGGCCGAGGTCAGCCTGACGGGCGACGCCAGCGACTTTGACTA
CCGGCGCATCGTCGCGGTCGGCTCGTTTCGCCACGACCAGGAAATGCTCGTGGGTCCGCGCGTGCGCGACGGCCAGGCCG
GTTTCTTTGTCGTGACGCCGCTCGAGCTGGCCGTGCCGCTCGACGGCTCTGCTGATGGTGCTCCACCGGCCACCATCCTC
GTCAACCGCGGCTGGATCGCCCGGGGGCAGCGTCCGCAGGCTGCCCGCGAGCACACACCCGGTGCCCTGCCCGAGGGCCT
CGTCCGTGTTGAGGGCCTCCTGCGCGCGCCCTGGAAGCGCAACGTGTTCACGCCCGACAACCGGCCTGACAAGGGCGAGT
TCTACTTCCCCGACGTCGTCGAGATGGCTCAGCTGACCGGCAGCCTGCCGGTCTGGGTCGAGGCAACGATGGGTAAGCGA
GAGGCTGGATGAGACGGAAAAAGAGACGGAAAAACCATGATCGTATTGGTCGGCTAACTCGTGCAGAACCCGACTTGCTT
CAGATCTATGACATGGAAGCCAAGGGCATTCCCATCGGAAAGCCGCCCGAGGTCAACATCCGGAACAGTCATGCTCAGTA
CATCTTCACGTGGTATGTAGCTGTCTGCACTTCTCCTTCTCCCCTACATCCTCATCCTGACTTCATTACAGGTACAGCTT
GTCGGTCGCGACGTCCGTCATGCTCTGGATGGTTCTGAGGAAGCCGCCATCGGACATGGCCCGTCGTGTGCGCATGAACA
AAAGCTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62