GenePrediction:GLEAN_6900 Details

Name: GLEAN_6900
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1017783..1015751 (- strand)
Length: 2033
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1017783..1017656 (- strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_108:1017544..1017408 (- strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_108:1017354..1015751 (- strand)
Length: 1604
>GLEAN_6900 class=GenePrediction position=GCSC_108:1017783..1015751 (- strand)
ATGCCGGCCATTTTTCAGGCGCTGGCGCCACCCCTGGGTCCAGTTCCTGACAACACGACGGCTGTCGGAATCCAAGTGAT
CTGCTCCTGGCCAGTTTCGGGGCAGTACGGCGTTGGATCCCGAATATTGTAAGTGGGGATTTTGAGAAGAAGAGGGAAGA
TGAAAAAAAGAAAAAGAGAAACAGAAGGTCCGAAAGAAATGCAGACAAATCCAGGCAGCTGACCTCCGCCGCCCACCAGA
TACTACGTCCTCGTCGCCGCCTGCGTGCTGGCCAGAAAAGAAATATGGATTCGCAATGCCTGTCTCGCGGCCGCACTTCT
CTTCCCAGCCGTGGCCGCCATCCACGGCATCGTTCTGGCCGCGCTGCACAATGACGGTATGTCCCCCGTCCTGCCCCTTC
ATCAGCGCACATCATATCTAACGGTCCAGCCGCCGTTGATCTGGACGTCTATGGTGCCTTCCAGTTCTGTGCCATCGGCA
TCCTCGCTGCACCCGTCACCGTCCGGCTCTCGAGCACGTATTTCTTCTCTCCCGGCCGCAATACCATCTTCCTCTGGACC
GGCATGGTGCTGGCCGGCCTCCTCAGCCTCACGGTCGAGTTCTACCGCCTGCATCCGGTCCCGTGCACCCACGACAATGC
CGGCAATCCGATCCCGTCCGACATCTCACAGGACGCTTTTCTCCGGCTCAACGCCACCTGTGGCCTCGTGTGCGACACCG
TCAACGGGCCCTTCTCACCCATGCGTGGAGGCTCTGCCAACAACATCGAGGTCGTCGGCGTGCCCACGGCCCTCAGCTTC
GACACGGCCACGCTGCTGGCGGCCGCCTGTTGCATCCCGGCCATCCTCTCGATCGCGTCCATGTGGAACACCATTGTCGA
GATCAACTGGCGCTCGCGTCGTAGCTCGGCCGATGACCCGCACGACGGTGACGACGAGCACGACGAGCACGCCGTGCGCA
GCAACATCAAAAAGGTCAACGCCACCATCGGCACCTTTCTGCGCGCCATCGAGATCCCGCTCTTTGGCGGCGCCGTGCTC
GCCCTTCTCATCACCGGCGAGCGCAACTTCTTCAGCCCCCAGATTTGGTACATGACCGAGCCCATGGCCAACGTCGGCCA
GTGGACCCCCGTCGTCGGCACCGGCTTCACCATCCTCTGGTCACTGCCGCACATCTTCTCGCGCGGAGACCCTGACGACA
AGCACCCGGACGAGCCGTCACCTTCATCGCAGTCACCGTCGCCGCCTGGCCTCGTGACCCCCTGTCACTGTCCACATTCA
CATGTCTGTCATAGTGCCAAAGAGCCCCTAGCCAGTAATGACAAGGGCTATTTCCACGATGCCGACCTCGAGCGTGGCCG
CGGGCCCATCCGAGAGTCGGAGGATGCCTCGCCTGACTCCTTCCCTCACGTTGAACACGTCTCTGACGTCGACAACGATA
CCGGCAGCCTCAGGCGCTCCGTCCAACTGTCGCAAGCGGCACGAACGCAGTCGCGCGCGACAGCCGCCACTGCCGTGAGC
GAGAAGCCGACTGAGGACTTGGGCAGCCGCCGCAAGGTCGCCCGCGTCCTCGAGCGCGTCGCCACCGTTTTCGACAACGC
CATCACGACACAATTTACCACCTCCGGCTTTGAGTCTACTCCTGGCAAGGACTTCCCCGAGATCCCCGCTGAATACCTTC
GCAACCCAGGCCTTGCCAGGATCCGCAAGAACTACCATATGCACCGAAAAAACAGCTTCAAGTCGCGACAATCTGTATCA
CCCTCCCCTCTCTTCTCTCGGCGAGGCGAGCCCAGCTCGCCGTCCCCGGCTGCCACCACTGGTCAGCTACGCCGATCTAC
CCTAGCACCTCCCTCCAACGTCTACGGTCACGACACAGTCACGCGCAGCTTCTCACATCCGGGCCCGTCACATTCCACCA
CCCCACATCCGCGGGTAGACGACCCTCCGCGTCCTATTATCGCACTCAACGCTGATCTGCTGGCAGCTCAGTCCTCGTCC
CAACCGCCCATCAGCCAGCCGCCAACACAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62