GenePrediction:GLEAN_6902 Details

Name: GLEAN_6902
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1009280..1006716 (- strand)
Length: 2565
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1009280..1009041 (- strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_108:1008970..1008335 (- strand)
Length: 636
Type: CDS
Source: GLEAN
Position: GCSC_108:1008270..1008235 (- strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_108:1008173..1008093 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_108:1008040..1007916 (- strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_108:1007851..1007787 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_108:1007715..1007566 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_108:1007512..1007209 (- strand)
Length: 304
Type: CDS
Source: GLEAN
Position: GCSC_108:1007142..1006716 (- strand)
Length: 427
>GLEAN_6902 class=GenePrediction position=GCSC_108:1009280..1006716 (- strand)
ATGGCTAGCACCCAGCTCGACCGCCCGGTATGGCAGGTTCGCCGTCCGGAGGAGACGAACACGGCCAAGTTCATGTCGTT
TGTCAACAAGCGGCACAACCTCAGTCTACAGTCCTACGACGATCTGCACCAATGGTCTGTCGGCGACACCAGCTTCGACG
CCTTTTGGCACGATGCGTACGAATGGCTGGGACTAGCCCCAGCAGGCACGACCAAGATTGGCAAGATGCTCCAGGGCGAG
GTAGGAAGCCGGCTGCCATTTCTGTTACCAACCCAGATGCGAAGAGACTGACGAAACCGGACGCGACCAGAATGCCGCGG
CCACACCGCTCTTCCCGCCGCCGACCTTTTTTCCTGACGACAGGCTCAACCTGGCCGAGTTTCTCCTCCGCCGGGGCCCG
GACGCGCAGGTGGCCATCCACTTTGCGCGCGAAGGCGTCGCCGACACGGAGCACGTGACCTGGCGACAGCTGCGTGAACG
TGTGCGCTGTGTACGCGACGCGCTGGCGAGCTCGGGCATCTGGGCGGGCGACGTCGTGGCCGCCGTGATCTCCAACTCGA
TTGACGCCATCGTGCTCTGTCTCGCCAGCCTGTCGCTGGGGGCCGTCTGGTCGTCGTCATCGCCCGACCTCGGACCTGAT
GCCATCGTCGACCGTTACGGCCAGGTCGACCCGTCCATCATCTTTGCCGACGACGGCTACGTCTACGCCGGCAAGCAGGT
CACGCTCACCGAGCGCATCGCCCAGTGGTCGCATGCCGTCGGCCGCGTCAGCGCCAAGCTGGCCGACGTCGTCGTCATCC
CGTACTGCGGCGCCGCCGTCGACACGTCGGCCATCTACCGCGGACGCACGTGGGACGCCTTTCTCGGCCGCGGCACCGGC
AGAGACCTCGACTTTGCCCTCATGCCGTTCTCCCACCCTGCCTTCATCCTGTTCTCGTCCGGCACCGTAAGCTCTTCCAC
GTGTCGGCCCGAGCTCCTGTCCTGGACCCATGTATTGACCAGATGCATAGACCGGAAAGCCAAAGTGCATGATCCACTCA
TCAGGCGTATGTCATCAACAGCTTCCATTGTACTGTGCGCGTGTACTGACCCGTTTGTGCGTTACAGGGGGTGGCCTTGA
AGGTACAGACCGATATGGTCTTGCAACATGACATTCGGCCCACCGATGTGGTCTTTCAGTACACGACGGTATGTGTGCTT
AGCCACACTTTCATGTTCACACGACTAACGGATGACACAGACGTCTTGGGTAATGTGGGTTCTCAACTTTGCTAATCTGT
CGACCGGAAAGTCCATGCTTCTGTACGACGGTTCGCCATTCCATCCTCGCCCGACAATACTTCTTGAGCTGGCACAGGAT
GTAGGGTAAGGAATATGTCCAAGTTCCAGTAATGTATCGGCATCCACTAATCTTCGTAATCATCTCTAGGGTCACTGTCT
TTGGGACGTCGCCACGGTATCTCGGAGACCTTAAGAAGCGAGGCATTGTTCCACGTATGTGATGGGTGGACGGTTGATAC
ATGTGCAATCCAGGTGGCACAAGCTGACCATCGTTCACACTGCAGGGGAGCAATTCGATCTCAGCAAGCTTCGAATGATG
ACGTCGACGGGATCCGTGCTGTCAGCCGAGCAGTACGATTGGTTCTACGATGTCGCCTTTCCACCGGACGCCCAGCTCAT
CTCCATGAGCGGAGGAACGGATATTGCAGGCTGCTGTACGTGCATGTTGTGTCTTGGGATTCGTGATCATGCTAACGGAC
GAGGACAGTCGTCGCGGGGACTCCACTTCTGCCGGTGTATCGCGGCGAGATCCAGGCCAAGGCTCTCGGCATGGCAGTAG
ACATCTTTGACAGCGCTCAGACGGAACACGTCTCGGTGGAAGCGACGGGAAACCCAGGAGAGCTCGTCTGCACGAAGCCG
TTTCCCAGCCAGCCGGTGACGTTTCACGGTGCCGGAGGCCAGGACCTCTACAAGTCGTCGTACTTTGAGCGCTTCGGTGT
CGGCGTCTGGTGCCAGGGAGACTTTGTACAGCGCATCAAGGCGACGGGCGGCCTGTTGATGCTGGGCAGATCGTGAGTAC
AGTCTCCCTCTGTGTGTCTACATCTTTGGGCTTTTGACGTTGTATACTGACAGAACAGCGATGGTGTGCTCAACCCGTCT
GGCGTCCGGTTCGGCTCGGCAGAAATCTACGCAGTCACGGAAAAGATGGCCGAGATTGCCGACAGCATCTGCGTGGGCCA
GAGACGAGACTGCGACGCGGACGAGAGGGTGCTGCTCTTTGTCAAGATGCAGCCGGGCAAAACCCTGACCCAGGCACTAG
AGCAGGACCTGAAGACGGCAATCCGGCAGACATATTCTGCTCGTCACGTGCCCCGCTTCATCTTCGAGGTGGCCGACATT
CCCTACACGGTCAACGGCAAGAAGTGCGAGATCAACGTCAAGCACATTGTCAATTGCCGCAAGGCAGCGGTTAGCGGCAC
GGTGGCGAATCCGGCCGCCTTGAAGCTGTTTGAGCAATTTCAGCAGCTTCCCGGGGACGAGGCTGTGGTCAAGAGCAAGT
TGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62