GenePrediction:GLEAN_6904 Details

Name: GLEAN_6904
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:947119..945888 (- strand)
Length: 1232
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:947119..946974 (- strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_108:946903..946838 (- strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_108:946781..946630 (- strand)
Length: 152
Type: CDS
Source: GLEAN
Position: GCSC_108:946567..946288 (- strand)
Length: 280
Type: CDS
Source: GLEAN
Position: GCSC_108:946221..946094 (- strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_108:946030..945888 (- strand)
Length: 143
>GLEAN_6904 class=GenePrediction position=GCSC_108:947119..945888 (- strand)
ATGCCTATCCCAGAGTACCAAGACATCGGCTCGCTGAACATTCTGGCTCAGCCAGACACCAAAACCCTATCACGCAAGTC
CGTCATCGTGACTGGAGGGGCAAGCGGCTTGGGAAAAGCATACGCTGAAGCCTTTTTTGCAGCCGGGTGAGTTGCGCCTG
CTCTAAACGGTGGGACGGACGGATCGAGGCAGAAGACTCATCTGAACGTTCTCTAGTGCTTTTGTTACCATTGCGGACTA
CGACGAAGTTGCGGGAAAGGCCACCGAGGCGCAGCTATCACCGTACGTGACAGTCCCAAGGATTTCTTCTAAAGCCGAGA
TCCTGACATTTGTCCCAGAAATGCCAAGTTTGTCAAGTGTGATGTCCGCAGCTGGGATGACCAGGTGGCCGTCTTTGAGG
GCGCCATCGCGGCATCCCCGGAACACAGCGTCGACGTGGTTGTTGCGAATGCCGGCATCGTCGGCGCAGATGACATGTTT
ACCCTAGATGGTAATCCCTTTCCGTCCTTCTCCTGACTGCCTACCGAAAGCTTACCGCGACGACACGAGCAGATCCATCC
GGGCCACCGGTAAAGCCAAATCTGCGCATCGTAGAGATCAACCTGATGGGAACTATATACACTACAAAACTCGCACTTCA
CTACTTTCGACGCCAGCCAGAGACTGCAGCCCGTGACCGCTGTCTCATCATCAAGGGCAGCGTTGCCGCCTACGCCGATC
AGCCGGGCTCGCCCCAATACAATATCTCCAAGTGGGGTGCTCGTGGCCTGTTTAGAAATCTTCGTCGCACCATCTGGAAA
GAAGGCATCCGGGTCAACTTTGTGGCCCCGTGGTAAGTCATGAAAGGACAGCAGGACAGTGGAACAAGTTTTGTGATGAC
TAATCAGCGTGCTTTCAGGTATGTGCGAACGCCCATTCTGTCACAGAAAATCATTGCGTATCTGGAATCCAAAGGGGTCA
AGTTTGCCACTGTGGAGGACTGTGCGCATGCGATGATCCAGATTGCAGCCAGGAAAGAAGTCAATGGTGAGTCCAGACGT
GCCCAACTGCGTGACACGTGCTCAACTGTGTACTGACCCAATCCTTCAGGCCGCGCACTTGGAATTGTACCTCGAGAGGA
GGTGGCAGAAGGGTTTGTGGATCTGGCCCACGACGACTACCAGGAGGGAGACTTTATGAAGGGCTGGCAGGAAATAGTCT
TGGCCACGGCGCAGTCGATTGTGGATCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62