GenePrediction:GLEAN_6905 Details

Name: GLEAN_6905
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:945513..942915 (- strand)
Length: 2599
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:945513..945335 (- strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_108:945266..944501 (- strand)
Length: 766
Type: CDS
Source: GLEAN
Position: GCSC_108:944363..943750 (- strand)
Length: 614
Type: CDS
Source: GLEAN
Position: GCSC_108:943701..943516 (- strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_108:943464..942915 (- strand)
Length: 550
>GLEAN_6905 class=GenePrediction position=GCSC_108:945513..942915 (- strand)
ATGCAGGGGAACCCACCTGCGAAACGCCCAGGCAGGGCACGCGGCCAGCGGGCAAAACGTGCCTGTCTGGCCTGCAGGGT
GCGCAAAATACGCTGCGATGTCACCGTGCACGGGATTCCCTGTCTGAACTGCAAGCTCGACTCGGAAGACTGCATCGTCA
AGCCGCGGGCTGGCAAGAGGTAGGTGGTGACCTCGTGCGTGCCTGTACTGGTGCTATAGGAAGCTGTATTGATGGCGGGA
ATGGTAGACAGTCTGCCAAGGCCGTGGCCGAATATCGGAAGCAGCAGCAGCAGCAGCAGCAGCTGCTGCTGCAGCTCGAT
CTTGAATCTGGGCCATCGCCAGGAAGCTTCAGCTCCTGCTCCACATCCTCCCCACAGCCAGACCTCAGTTCTGCCAGTAT
CACCGGCCTCTCAGCGGACAGGCCATACGAGTCCTTCATCGATATGGATGACACCCTCTTTGCCGAAACAGACGATGGCC
AGCACGAGGAGAGGCCTGGACACGGTGTCGACATGCTGGATGAGTGCAACATGGCCGTCGAAGGCGCTCTGGGCCCGACA
GCCGTGTCTCCTCGCGATCGTATGGACTATGGCTCATCCACCCACTCTTTAGGCGTAGCCCAACCTCCTCTGTTCCTGCC
TGCGGCCAAGACATCGGAACCTCTGCACTCGTTTGTCCCCTGCATCTGCTATCGCTTCGTCGAGGCCGACACTGCATGGC
GTCTGGGACCGGCGGATATCGCGTTCCTGGAACAGCGGAGCTGCTTCCGCCTCCCCGAAAAGGCTGCTCTGGCCGCCTTT
GTCGCGGCCTACTTCCGTTACGTCCATCCTTTCCTGCCGGTGCTGAACGAGGCCGCATTCTGTACCGCCTACGCAGACCA
ATCGGCCGACTCGACGGCCGGCCAGCGAACCCCCTTGTTTGTCTTCCAGGCCATGCTGTTCATATCCTGTCCGGTAAGAG
GACCCCTCGTGGGGCCGATGGGCATCGACTTCGGAAAGCTGACAGCATCGACAGTACGTTCCAGTGTCTACGCTTCGAAG
CTTGGGGTTCGCCACAACCCAACAAGCGCGTACAGAGTTCTATTCTAGAGCAAAGGTTTCTTCTTTCCGGCTGGCGCTTA
TTTTGCCTGCTTTCTGACCCTCGGTGGCAGGCTCTTTTTGACGTCGACGTGTTCAAAGACGATGTGCGCAGTGCGCAGGC
AGCCCTGATGTTGACATATCAAGCGCCGACGCCCAACGACAAGACCAGCTCGTTCTGGCTGGCGGTTGCCGTCCACTACG
CACAGCGAGCCCAGGCGCACAGGTACCTCGCAAGCACAAGCGCGGCCCGGCAGGCAGTCCTGAAGCGACTGTGGTGGTGC
TGTATTCTTCGGGACAAGATCATGGCCCTCGGCTTGCGGCGACCACTGCACATCCAGTCATCCGATTTCGATTTCGACCA
TAACAGCCTCAACGAGGGCGACTTTTGCGACGAGATTCTCCATTCCGATGTGTACGACCGCCCGACGAAGCAGGTTATGG
TGCAGCTGATCATTGCGCTCTGCGAGCTCATGGGTCCTCTGCACAGCATCCTCACCATGATCGATCCCATGAAGGGCATG
GGCGCCGACAGCAACCAGCCAACGCTGCAGGAGCTCAAATGCTGTCTCGCCCGGCTGGACCTGTGGTACCAGAAGGCAGT
GGCACGGTTCCAGATCCCGATGCATATCTGCGGCGTGAACGAGTCGCTGATTCTCTTTACGAAAATGATCTACATATACT
ACTAGTAAGACGCGTTCTGTCTGCCTGTTCTCTTCCCTGCTAACAGTCGTAGTACGGCCAAAGTGCTGCTATGCCATCAC
ACTATCGTGCTCTGTGTCACGGACAAGGATGACCAGGATGCCGCCCGGGAGCTGCGGCTGCATGCACAGTCGGAAATCAA
CACGGCTCGCCGCAAGACGACGGTCGATCTCATGGAGCTCCTGCAGCGCGGACTCGCCCAGTATTTGCCAAATACCTTGT
ACGTGGTACAAGTATAACACAGGTCGAGATTCAAACTGACACGAAGCAGTGTTGCCTTCTCGGCTTTTCCCTTTGTGTGG
TATATCCTGGAGACAAAAGTGACAAGTAGTCCCCTGGGAAATGACCAGGCTTCGCAGCCCATACAGACATACAAGGCCAT
CATGCGGGGCTTCCGAGAGCAGCACGAGAGTGCCGACGACGTGTTGCTGTGCATCCAGTCGATTGTGAAGCATATTCAGG
AAGTATGGCCCCCGCAGCGAACCCACGAACGACCACGAGAATACGCTTCCTACTTGCTGCAGAATTCATATCAAGATGCG
GTACTGGAAGAGATCTCCGACAAGCCACAACGCCCACATGATGTATGGACAGATCTGCTGGTTGGAAGTCCCCGGAGATA
CTGTCAGATTCTGCTTACCGTCGACTATTTCCTTTCCTATGGCTGCTTTCCTTCTGAGAGTGACTTTCCCAAGGTCTTGC
AGGGCCTGGATATGGAGAAACCTAAAGAGGACCTTGAGGGCGGTGGTGATGTGGACACGCCGGCCAACTTCGACTTTTAT
CAATGCCTCGAGCAGGCACTTGAAGCGGTTCTCTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62