GenePrediction:GLEAN_6907 Details

Name: GLEAN_6907
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:936501..934148 (- strand)
Length: 2354
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:936501..936061 (- strand)
Length: 441
Type: CDS
Source: GLEAN
Position: GCSC_108:935989..935916 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_108:935850..935842 (- strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_108:935777..935680 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_108:935612..935083 (- strand)
Length: 530
Type: CDS
Source: GLEAN
Position: GCSC_108:935023..934893 (- strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_108:934838..934716 (- strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_108:934655..934433 (- strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_108:934375..934148 (- strand)
Length: 228
>GLEAN_6907 class=GenePrediction position=GCSC_108:936501..934148 (- strand)
ATGGCAAAAACCCTCGATAGCGGTATCACGGCTTTGGCCCCGGTCTCGAATCTGCCTGATGAGTGGTCCCCGCTGCTATC
GACCTCCGAGAGAAGTGCCAATGCCGACCGCCCCATTTCCAGCTCTACGGCAGAGTCTCTCGCGACAAACCCGTCCTTGC
TCACCGATATCGAGGCCGATGCTGCCACACCTGTGACCGATGGAACTATTACGCCTCGCCGAAATGGCGCTGGCAACCTC
ACGGGCTCGCGCAGCAGCATCAGTCTGTCCGCAGTTGTCCATGCCGTGCTCGTGCTCATGATCGGCGTATTTGTCTCCAA
CGTCGATGGTTCCCTCATCATGGCAACCCACCCCATCATCGCGTCCGAGTTTGATGCCCTCGAAAGCTCTAGCTGGCTCT
TTTCTGGCTTCATCCTGGCCGCAGCCGCAACCCAGACCATGGTGGGTCATGCCTTATCCTGTCGCTCGGCAATGGGCGGG
CCAGAAAATACTCATGACCTCTCTTTGTTTAGTACGGAAAACTCAGCGATATTTACGGCCGCAAGATCCTTGTTTTGATA
TCTTACATATTTTTCACCGCTGGCTGGTAAGATTTCTGTCAGAGACGTGTCCTGGACGTCCAAGAACAGCACATGCTAAC
ATGCACTACAGTGCCTTGGTGTGAGTACTTTTGCGCTTCTGTCTTGACACTAGCCTCGTGTGCGCCTCCTAATCCCCGTT
TTAGAGGCGCTGGCCAGACCATGTTTCAAGTCATCCTAGGCCGAGTCATATCTGGTGCTGGCAGTGCTGGCATGACTGTT
CTCGTGTCGATCATTGTATCTGGTGAGTTGTGCCGCCAAACGCCCAGAGAGTTTTGGTTCCCCTCCTCACCTCCTCGCCT
TTGTCGCAGATCTCCTTCCCATTCGTGATGTTGCCTCGTGGCGTTCCTACATCAATGTTGTCGCTACTACCGGCCGCAGT
CTCGGCGGCCCGGTCGGTGGATGGCTGGCCGACGTTATCGGCTGGCGCTGGTCCTTTTTCGGCCAGGTCCCCTTCATGCT
ACTGGCCACTATACTTGTCATGCTGTTCTTACCGAACCACTCGAGGAATTATAGCGGAGGCCAGCCACTGGACAGCGAGT
CCTCCCGTGGTGAGATCTCGTCCTGGCTTCGTCTCCGACGTGTCGACTTTGCCGGATCCGCCCTGCTAGCTCTGGTGTTG
CTGGCGCTCCTGATTCCTATGGAGATCGGTGGTATCAAAGTGTCATGGACGAGTCCGGTCATTCCGGGGTTGTTTGCCGC
CTCACTAGTACTGTTCGTCGCATTTTTGCGTATTGAAAAGCGTGCGATCGAGCCGATCGTGCCGCTGGGCATCTTTCGTG
TCCGGGATGTCAACCTTTCTCTGCTCATCCAGACGTTACAAACGGCCGCACAGTTAGGCGTATGTCCTCGAGTCAAACTC
CTCTTAGTCATAACTGTGTCTCTAATATACATGCGCAGATAATGTTCTCGGTCCCACTCTACTTCAAGGTGTCGCAGGAA
GTGTCCAGCACTGTTGCGGGCGCCCATCTCTTCCCAGCCGTGGCCGGCAACGCTATCGGCGGTATCATCACGGGCCTGTA
CATCAAGAAGTGCGTCCAATTTATCCTATATCAACCCGCAACGAGGCTGACACGTATTACTAGAACCGGGCGCTACCGGA
ACATGACCCGGCTGGCGACCATATCGTCGAGCCTGTCGTACTTTCTACTACTGCTTCGCTGGCACGGTCACACCAACTGG
TGGGAGGCGTTGTACATCTTTCCCGGGTATGCTCTCAGTCGTCCCTCGTTCTACTTACTTTTCAGAACATTTACTAACCC
GGACAGCGGTTTTGGAACGGGTGTTGCCACAAGCGCGGTTTTCATTTCCGTGCAAGTGGTCGTCGAGCCGATACATTTAG
CCCCAGCTATCTCCATACTCTACCTAGGCGGCACCTGTGCATCGGTTCTCGGGCTGACTTCTGCTAGTATGGTTATGCAG
GCAATGCTCAAAGTCAGTCTGGGGCGCCGCCTTCTGGATCTGGGCCTCGATGCTTTTCAGCGTGCAGAGGTTTGTTTCCC
GTATGGTCTGCAGGTCTCAGAAGGCACGTAGCTAACCTGATTTCAGATCGTATCCAAGGCCGTGTCCAATATAGGCTATG
TGTCTGGCCTTATGGGACCAGTAAAGACTGCCGCCGTCAGTGCCTACATCGATGGCATCTGGTGGAGTCATAGTAGGTAC
CCCTCTTATTGGCGAGACGAGATATCCAAGCTGACAAATGGTAGCCGTGTCTCTGCTATTCTCAACTTTGGCATTGATGT
GCTCTCTTCTCCTGGGCGAAAAGCCTCTACATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62