GenePrediction:GLEAN_690 Details

Name: GLEAN_690
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1460861..1461918 (+ strand)
Length: 1058
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1460861..1460890 (+ strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_97:1461043..1461075 (+ strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_97:1461178..1461236 (+ strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_97:1461307..1461487 (+ strand)
Length: 181
Type: CDS
Source: GLEAN
Position: GCSC_97:1461550..1461782 (+ strand)
Length: 233
Type: CDS
Source: GLEAN
Position: GCSC_97:1461855..1461918 (+ strand)
Length: 64
>GLEAN_690 class=GenePrediction position=GCSC_97:1460861..1461918 (+ strand)
ATGGCCGCTCCCGGCGTTCAGTCCTTGAAGGTGCGATCTATCTCTGCAGCGCGGACTTGGAGCGTTGCCAATAGTTCGCC
CGAAGAAACGCCCGAGGCAACCGCCCGAGGCGGATCGGTGGCAATGGCCGAAGAGTAATTCTGCCAACGATCGCTGCATG
AAGGCTGACAATATTGGTACAGTGTGTCGTGACCGGCGATGGTGCCGTCGGCAAGGTACGTCTTTTTCATTCTGGTCATC
TGCCTTTGTGATACCCAAGATCTCTGGTCGCGCACAGCCTTTTCCACAACCTTTTCTAACCTTGGTTTTCCCAACAGACA
TGTCTCCTAATCTCATACACAACGAATGCCTTCCCTGGCGAATACATCCCGACAGTGTATGTCTTGTCTTTAGCTGTGTG
CTCATATCCGCTCATTGCCAGTGAACGGCTGCTGATAGTGAGACAGGTTTGACAACTACTCAGCCAGTGTGATGGTAGAC
GGGAAGCCCATCAGCTTGGGCCTTTGGGATACCGCCGGTCAAGAAGATTACGACCGTCTGCGCCCACTGTCCTACCCCCA
AACCGACGTTTTCCTTATCTGTTTCTCAATCGTCAGCCCGCCGTCGTTTGACAACGTCAAGGCAAAGGTACGCTGGTGCT
TCGAGACGCGGCCCTCGCATGGCGTGTTGCCGTACTGACAGCGGTTCAGTGGTTCCCCGAGATCGACCACCATGCTCCGA
ATGTTCCCATCATCCTCGTTGGCACCAAGCTGGATCTTCGCGAGGACCAGGCTACGCTCGATTCGCTGCGCCAAAAGCGC
ATGGAGCCCGTCTCGTACGACCAGGCTCTGATCTGCGCAAAGGAGATTCGTGCACACAAATACCTCGAGTGCTCGGCTCT
GACGCAGCGTAATCTCAAGAGCGTCTTTGACGAGGCTATCCGGTACGCCCAGCCTCCTTGTTTCTAGGTTGTTCGTTCGC
CAGTCTCTGCAGTGTTACTAACTGTTGCTCACAGTGCCGTGCTCAACCCTCGGCCAGTCCAGCAAAAGCCGAAGAAGTCC
AAGTGCACCGTCCTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62