GenePrediction:GLEAN_6910 Details

Name: GLEAN_6910
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:924392..921864 (- strand)
Length: 2529
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:924392..924381 (- strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_108:924330..923707 (- strand)
Length: 624
Type: CDS
Source: GLEAN
Position: GCSC_108:923654..923378 (- strand)
Length: 277
Type: CDS
Source: GLEAN
Position: GCSC_108:923311..921864 (- strand)
Length: 1448
>GLEAN_6910 class=GenePrediction position=GCSC_108:924392..921864 (- strand)
ATGGCTGCACTTGTATGTTAATCACGACCTCACCCCTGAACCTCGACTCACATCTGTCTCAGCGGAGGGTGATTGCTCCC
ACGGCTGCCGCCGCCTTGCGGCTGCACTCACAGACCTTTTTCGCCCGCTCTCGAATCCTCTCGACGTCTGCGGCGCAGCT
GCGTGCCTACACATCGACCAGTCGCCGACGACAGCTGTCGGCCTTCCAGTCACAGCTCGTGAGCACGCCCGATGCCGCCG
CCCTCCTCCACGCCTCCCAGAAGACGGCCGCGGCCGCACATCCCCAGACTCTCACAGAAAAGATCGTCCAGCGCTACTCC
ATCGGCCTGCCAGCCGGGAAGAAGGTCAGGTCCGGCGACTATGTCACGCTGGCCCCGCACCACTGCATGACGCATGACAA
CAGCTGGCCTGTGGCCGTCAAGTTCATGGGCATCGGTGCCACCAAGATCCACGACAACCGGCAGGTGGTCATGACGCTCG
ACCACGACGTGCAGAACAAGACGGAAGCCAACCTGAAGAAATACCGCCAGATCGAGGAGTTTGCCGGCAAGCACGGCGTG
CGGTTCTACCCTGCAGGCCGGGGCATTGGCCACCAGATCATGGTCGAAGAAGGATACGCCTGGCCGTCCACGGTTACCGT
CGCGAGTGACAGCCACTCAAACATGTACGGAGCTGTGTCTAGTCTCGTAAGTGTCTCTTCTTAGACATTGCCATCACTCG
CCCTAATGTTTTGTACAGGGCACCGCTGTTGTCCGGACCGACGCCGCCAGCATCTGGGCCACTGGCCGGACCTGGTGGCA
GATCCCGCCCATCGCCAAGATCACCTTTACCGGCATTCTGCCGACCGGCGTCACTGGTAAAGACGTGATCGTCGCTCTTT
GCGGCCTCTTCAACCAGGACGAGGTTCTCAACCACGCCATTGAGTTCACCGGCTCCGAGCTCAGCATGGGCAGCATCCCG
GTCGATGATCGCCTGACCATTGCCAACATGACGACCGAATGGGGTGCCTTGACTGGTAAGGCGATGAGGACGCAAACGTT
CGGCGGAAGCTAGACGCTCACAAACGCTGACCGCTCATCAGGACTGTTCCCCGTTGACGACGTGCTTATCGACTGGTACC
ATACCAAGGCCACAGCGGCGGCCATTCTCAAGAGCCCTTTCCAGGAGCGCATCAACCACGAGCGCATTGATGAAATGGCC
GCAAACCGTCTCGTTGCTGACCCAGGAGCGACGTATGCCAAGGAGTTCTACCTCAACCTGTCGACCCTCTCGCCCTTTGT
TGCCGGCCCCAACTCGGTCAAGATCGCCACGCCGCTCAAGACGCTCGAGGCCGAGGCTATCCGCCTAGACAAGGCCTACC
TCGTCTCCTGCACCAACTCGCGCGCTTCCGACATCGCTGCCGCCGCCCGCGTCTTCCGTGATGCTGCCAAGGACGGCAAG
CCGGACAAGGTCGCTCCCGGTGTCCGCTTCTACATTGCCGCGGCCTCCATCCTCGAGCAACAGATTGCTGAGGAGGCTGG
TGACTGGCAGGTGCTTGTGGAGGCCGGCGCCCTAACGCTGCCGTCGGGATGCGGCCCGTGTATTGGTCTTGGAACCGGCC
TGCTCGAAGCCGGCGAGGTCGGTATCAGCGCCAGCAATCGCAACTTCAAGGGACGCATGGGCTCCACGTCCTCCAAGGCG
TACCTCGCCAGCCCCGAGGTGGTGGCGGCCAGCGCTCTCCAGGGCACGATTGCCGGCCCAGGATGGTACCAGAAGCCCGA
GGGCGTGGAAAAGGTGATTATCGGCGAGGGCAGCGGTGATCACGTGGTAGACCAGACGCGGTCCGTCGAGGATGCGCTGG
ACCGGCTGATTGACGAGGCCGAGAGCCTAATTGCGGCGGCCGAGGGCTCTGTCGCGGATGAGACGAGCAGCTCATCCTCT
CCTGCCGCCGCTGCCGAGGACGAGACCCTGACAGACATTCTGCCCGGCTTCCCCGAGAAGATCGAGGGCGAGATCGTGTT
CTGCGACGCCGACAACATCAACACGGACGGCATCTACCCAGGCAAGTACACGTACCAGGACGGCGTGTCCAAGGAGACTA
TGGCCGAGGTGTGCATGGAGAACTACGACACAGCCTTCCGGACGACGGCGCGGGCGGGCGACATTCTCGTCAGCGGCTTC
AATTTTGGCTGCGGCTCCTCGCGCGAACAGGCGGCCACGGCTATCCTGGCGAAGCAAATTCCACTCGTCGTCGCCGGCAG
CTTCGGCAACATCTTCAGCCGCAACAGCATCAACAACGCACTCATGGGCGTCGAAGTGCCGCGCCTGGTCCAGCGGCTGC
GCGAGACATACAAGGACGCGGCCGAGAAGCCGCTCACCCGCCGCACCGGCTGGACCATCTGCTGGGACGTCCGCCGCTCC
AAGGTCGTCGTTACCGAGAAGGACGGCGCCAAGTGGGAGCAAAAGGTCGGCGAGCTGCCGCCCAACGTGCAGGAGATTAT
TGCCTGTGGCGGCCTGGAGAACTGGGTCAAGTCCAAGATCGAGGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62