GenePrediction:GLEAN_6911 Details

Name: GLEAN_6911
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:919946..918171 (- strand)
Length: 1776
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:919946..919747 (- strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_108:919664..918836 (- strand)
Length: 829
Type: CDS
Source: GLEAN
Position: GCSC_108:918203..918171 (- strand)
Length: 33
>GLEAN_6911 class=GenePrediction position=GCSC_108:919946..918171 (- strand)
ATGCCTGACTTCCAAAGTCCACCATCATTTGCCACAAGAATCCCGTCACAAGCGGCGTCATCTCGTTCACCTCTAGCAGG
AGGCTCGACGCAGACCGAGTTCCCCAATGGCCCAGAGGACGCCAAGAAACACATAGATTTTATCTGGTACAAAAAACAGA
AATATGTCGGTGATGGAATGATTCAAGGTCTCCTTAATCTGTGAGTAAATATCAGCCACAGCTTCCCTATCCCCTATAAT
TCCAGAGTTTTCGGAGGCAAGCGACGCCTAACAACAATAAAGGGCGAGCAAAGGACAGAACAGCAAAAGCACCCATTTCA
TCTATGAGCTTCTCCAGAATGCCGACGATGCCTCCTATGGCGGTAACGTACCCCGGGTGTGCATCCGTTATGATACGACA
AATCGGACTTTTCTCATTGAGTCTAATGAGATTGGCTTCACCAAGGCCGACGTGGAGTCAATTTGTAGCGCAGCTGAAAG
TACCAAGAGCAAGAAAATGCCAGCAGCCTCGGCCACCGCCACGACAGAGAGGTCGATTGGCGAGAAGGGTCTTGGATTCA
AATCTGTTTTTCTTGCTGCTGACAAAGTGTGGATCAGTTCTGGGCACTACTCGTTCCGCTTTGACGGGGAGACTCCGGTG
GGACAGATCCAGCCTATCTGGGACACCCAATTTCCCGGTCTGAAGACAGATGGTTTCACCGCCAAACTTTTGCACATCCC
TATTCGAGACAGAGCAGATACTCTGGAGGCTCTGGTCGAAGAACTCAAAGCCCTGCAGGCTCTAGACCTCCTGTTTCTAA
GAAAGGTCAAACGCATCGAAATTGAAGACTGCACCCAGGGGCATAAAGACACAGCATGGCACACCAAGCTCCGGGTCGAC
GCAATCCCGAGATTGCTTAACATACTGACTCCGGTGAGAGTCTATAAAGACGACGACGTAGAGTCCTTCGTCGTTTTCCG
CTACCGAGTGACAGAGCTCCCAATCACATCTGAGCGTTTCGGGACCATGTCCGATATTATCCTTGCCTTTCCTAGCAATG
TCCCAGCCGCTACAAACCTTCCAACGAAATCTACGTACGCTTTTCTGCCGATCTCAACATACGGCTTCAAGGTAAGCAAA
AAGTTCCGTTACATATATATTTATATATGTTTGAAAAAAGCAAGGCCATCATCGAATCAACAATTTAAGCATGAGAATCT
AGTTCGTCATCCATGCAGATTTTACCCTTGTGGGAAGTCGTGAAGAAATCCAGGATACCGAGTGGAATAAGGAACTCGCG
GCAATGATTCCCCAGGCCTTTGCGGCTGCAGCTGGCCAGTTTCGTCTACGGCAAGAATTTGAATACACGTGGCCTCGATT
GCTCCCTTTTCACGAGCCACAAGCGAAACTATTTCGCAGTTTTGCCCAGAAAACAGTCGAAGCCCTTTCCGGTGAAAGAA
TTCTTCAAGATTTCAGGGGGAGGTTTTTATGCCCTGGGCAGCTGCGGCTCGTTCCAAAAGATTTCCGGGACAAAAACGGA
GATATATTGCTTCCCTCAAAATACTCCCCATGGAAATTGATTTCTGAATCCTATCCAGTCGATGCTAGAGAAAATCTTAA
AAGGCTCGGCATCTGTCCATTATCCAGTGCCCAATATTTGGCACACCTAGAGCAGTTTATATCCAAGGCCCGAGCGGAAT
ACCAGAAAATGCCTTCAGCGTGGCACGATCGCCTAAGCGAGACACTCCTCTATGTCCCATCAGATCTTTGGACCACAATC
AGACGTCTGGATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62