GenePrediction:GLEAN_6912 Details

Name: GLEAN_6912
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:916115..912361 (- strand)
Length: 3755
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:916115..915591 (- strand)
Length: 525
Type: CDS
Source: GLEAN
Position: GCSC_108:915359..915079 (- strand)
Length: 281
Type: CDS
Source: GLEAN
Position: GCSC_108:914991..914664 (- strand)
Length: 328
Type: CDS
Source: GLEAN
Position: GCSC_108:914562..912595 (- strand)
Length: 1968
Type: CDS
Source: GLEAN
Position: GCSC_108:912384..912361 (- strand)
Length: 24
>GLEAN_6912 class=GenePrediction position=GCSC_108:916115..912361 (- strand)
ATGCTGCAAAATATTGAGGTACTCGAAGCGGAGAAAATTAGACTGCTGTGGGGCCTGCGCTTGTCTGGCCGGATAATCTA
CAGTCGCCTAACCGATGGCCAAGTGGCACTTAGCATCAAGGACCAGAGTAACGACGAAAAGAGCCTAGTCATTCACATGA
TCAACGAATACGGCGCCCTCGCAGAGGGATTTGTCCCATCACAGCTGATTCAGCTTCTAGCCGAGTTTTGCGGCATATGG
GAGTCCCAGAAAATTGCACTGCTCGCACAGATACTAACCCAAAACAATCTGAAGCTTATTGAGCTAGACCTAAAGCAGTG
TGGTGTAAATGACGATGAAAATGGATATGCCGAGTCGAACTATGGCAAACCACAGGCAGAAAGACCGGAACTGGAAAAAC
TGGAAAATGCAGGTCTAACAACCACAACAGAGGATTCAATGGAAACAGAGGATGCAGAGAGCACAGAGGACGAAACGAAC
AAAAAGAACGAGAAGAAAGCCAGCAATGAAGAGAAAGGAAAGAAAGTAAAGCAAAAAAAGGCCAGGGGATCATCACATAT
GAGAAGCAACGGCTGGGGGGAAATAAGAAAATCAAAACTAAGAGGGTCTGGAAGACGGCTAACGATAAAGTCACCGAACG
CAGCAATTGAGACCGATCCGAGTTCCTATGCGACCATGACAATAGGGGGGATCAAGACAGAGCTAACCCCCCTTTTCCTT
ACAGACTTGATCGAAACTTCAGCACCCTGTGAACAGATTGCGAGCTTAGATCAGGTGATCCTCAATGAAGATGATATAGC
TCAGCCAGGCGGCAAAAAGGACAATGCACTGTTCATTAAAGACCAGAAACGTGGCTTTGAAAAACTTCGATCTGTATCAT
CAGGATCAGAATCTCCCAGTTCTTCGGAAGACTATATCCCGTGGATGGGAACCGGAGCTAAGGACTACGACAAGGCAGAC
CTACAAAGGAGAAGTTCTGAAACATCCGAACGAGGTTTCATGAGCATGAGCCAGGGTGTGTTCTCAACACCCTCCTCGTA
TATGATATTCAGAGGAGGAAACACCAAAGACACAACGTATTACGGAGAGCTATACGCAAGTTTTCTTTTTTTATTCTATT
ATAGTTTTGCCGATGGTCAGGCGGTACTAAACTTTCTGCAGGTGTCGCGGTTTCTTACCTCGTTTCTTGATTCGGAATCG
TACAACCCCGAAAGGGATTGGACAAGTCCTATGCGGCAAAGGCATGGACATGGGGTGTATGTTTACCGGGCGGATGATTC
CACATTCCGGATACAGGAAAAGGGCCGTGGAAAGCTTAGAGCCGCTGTGATGCAAAAGAATGGTCTAGGCGATGACTTCC
TCCCCGACTCTTGCACTTTCCACATCCAGGTCTGCGCAACGAACGCTGGCCGCGACGCCCTATTCAAACTATCCATATCT
CAATATATGAAGGTTTGCTTCCCTCCACTTTCCTGTCTTATATTGTCCCCGTGCTCTTTTCTTATCTCGTGTACGGGGGC
TTACCGTCTATCTCGTTTTCTTTTGTATTTTAGGCCAAACTTATGCGTCTCCAAGCCGACTACAGCGACGTTTATATTAT
AGCTCGCGTATTCTCCGTCCTTAACAACGATCCGGGAATAGCCTTGTACGTGGACCCTTGGGGTCTCCACGAACGAGGAC
ACATCACGCTTGAGCCGACAGCAGCGTATGTAGGTAGTATTCAGCTGGACACCCCTGCTCTGCTGGAGGTGAGCCGTGCA
ATAACCGACTTGGGGGCCTCCGGGACAGACATCTATAGGGATCTCCCGGTTGACGGAAAGCACATCCGTCTGCTCGAGCT
AGAGATCGACAACGAGGCGGCCGACAACATTGACAAGGACAACGCACCTCTGAGGGCCAAGTTGGTTTGCTTAGCGCTCC
AGCCACCTCAGACGCGCTTTTGGGCCATCTCGTACGTCTGGGGGACCAAAGACGGACACGTGATCGAGGTGAACGGAACT
GCAATGCCCATCACCGATTCCCTGTGGGCTTGTCTGAAGCAGCTTCGGGCCCGCCATCGGGTTACAGGAGACAGGGTTCC
GGTATGGGCTGATGCTATCTGCATCAACCAGAAGGATGACATTGAGAAAGCGATGCAGGTGCGGCGCATGGGCATCTTCT
ACAGCAAGGCTGACAAGGTGGTGATATGGGCCGGAAACGAGACTTCTGAGACCTGTGGTGCCCTCCAATCTCTCGACCAG
TGGAACAAGATGTCCCAGCTGCAGAACGCAGAAATTCACACGTCTTCCGATACTCTCCACTCCCCACCACGCGAAGACGC
AGCGCGCATAAATGCCCTGCTTGAGTGTCCATGGTTCACGCGCGCATGGACCATCCAGGAGCTCGTATTCGGATCGCAGG
TGGTCATAATGTCGAATGTCTCGGAGCTCCCGTGGCAGACTTTTATAGGCGGTGTGATTTCAAGTGGGCAACGTCTCCCG
AACATTCATGCAGACGCGGCTCTGGCCCTAAACGCAACTCGACGGTACTACAATGGGAGGACACCGGTACAGTCCGGGAG
AAGAGGCGGAGGGCTCAAGTACTCGTTTCTTGAGCTTATAGAGCTCTTTTTCTACGCCCAATCTACACACCAACGGGACC
GGCTCTTTTCCCTACTCAACCTGGCTTATGATACAACGGTGGACAAGGAGGGCTTCTATCCTGACTACAGCAATCTGTCG
GACCCCAACCATGATGTTGTCATACTGTCAAGGTACGCTAAGGCCTTCGTTGAGGACAACCACGCTCTTAACCTGCTGCA
TCATGCCGGTAGCGGCCGAAGCAGCCGCTTCTGCACCTGGATACCAGACTTTTTCAACGAGCACAACCAGCTTCGCTACG
CACCCACAATCTCAAGCTGGAGCGCTGCCGGTCCATCATCGTGCAGTAGTGAGATCCAGGTGTCTGGCGCCGAACAGCAC
GCATTCTGCGCGGATCGATTCCCTTCTCAGGCTTACGTGCTGGAAGTGCCTCCGACATCCCTGTTGTCGACCCAAAACTA
TGACATACCTGTTCTTGCCATTATGGGAAGACTGGTCGACACGGTCCAGACCTGTGGGATGCATATTGATAGCAAATCTA
TACATTTCAGCAACACTTTAAGAGACTTCCACAACATCCTCTCGCCCCTAAATGGATACCCTCACTGGGACCCAAGTACG
AGCAAGGGCAGCTGGAAGGACAAGAGGAACAACATCCTTGTCCGGTGCCTGATAGGGGATGCCGCAGGACCACATGTCTG
GTTGCAGCACCGGAATTATTTCTTCCGAAACGATGCTAGTCAGGGGACCGGAACACCGCCATTAGCAACATCAACATCAC
CGGCCGAGAGGTGGCCGGCAGGATATCAGAGCCAGATCCTGCAAGTGCCACCCGGATCAGACGGTTGGACATTCCTAAGC
AAAAATGAACATGAGAAGCGCACGATCAACAGCTACTGGAAAACAGTTGCAGCCTTCACAGAAAGGATCCAGAAAGCGAC
AGTATGCATTACCCGCCGGGGCTATGTTGGTATCCTGCCGGGCGTAACCAAGCCAGGTGACCGTGTTTTTATTCCGCGCG
GATCGCGCGTACCATTTGTGATAACGAAACGAGGGGGGGTACACGTAGGTCCCGTCTATTACGAGTTGGTTGGAGAGTGT
TATGTGCATGGGATAATGTATTCAGAGGCCCTTGATATAAACGAATTGCAGGACGAGGAAGTGCTTTTAGTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62