GenePrediction:GLEAN_6914 Details

Name: GLEAN_6914
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:899594..898744 (- strand)
Length: 851
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:899594..899457 (- strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_108:899374..898973 (- strand)
Length: 402
Type: CDS
Source: GLEAN
Position: GCSC_108:898923..898744 (- strand)
Length: 180
>GLEAN_6914 class=GenePrediction position=GCSC_108:899594..898744 (- strand)
ATGGGGGGACAGACGGCCCAAACTGCCAAAGCGAACAGCATCACGGTGACCAACGTTGCGCTTCAGCCATCTCGCCACCA
GAACCGGGCAGTCGCCGACCATCTTTCGCCTCGCAACAGACCAACGGAGACCATGCCGGTGAGTTGATGCAGCGTTTCTT
TTCGCTCTCGTCGAAGCCACCTCCCTCTTGGCTGGACCCCTCGTCTTACCTCGTCCGCAGGCCTACAACTCCGTCTTCAA
CAGCGATCCCGCCATTGCGGAGGGCCGCATGGTGGGCAACATACCGCTGCTGCCGCTGCGCACCAAGACGCGCGGGCCAG
CCTACGTGCTCCCGGCCGCGGTGCCACCGCTGCCGCTGAGCGAGGCGCCCGATCCAGACAGCGAGAGCTACGACATCCTG
GACGAGATCCTCGCCCTCTTTCGCGCCAACACGTTCTTCCGCAACTTTGAGATCCAGGGCCCGGCTGACCGGCTGCTCGT
CTACGGAATCTGGTTCGTCAGCGACTGCCTGACCAAGATCAAGCCGGGTGCCAGCCTGCGCGAGGCCACCAAGGACGTCA
CCAATCTGGCGCTCGACACCAACTTTGCCATTCCGGGCGACCCGGCCTGGCCGCTGAACCAGGTGCGTCTTGCCTCCTTC
CTCTTCTCCACTGCCCATGCTGACGTTTCAGATGTACGAACCGCCACGAGACCGACAGGAGTCCGAAGTCCTTCGACAGT
ACCTCTCACAGGTTCGCCAGGAACTCGCTCAGCGGCTGCTCGCACGCGTATACGATGCCGAGGGCGACGGCAAGCCCAGC
AAGTGGTGGCTCAGCTTCACCAAGCGGAAGTTTATGGGCAAGGCTCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62