GenePrediction:GLEAN_6915 Details

Name: GLEAN_6915
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:889960..889411 (- strand)
Length: 550
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:889960..889944 (- strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_108:889861..889411 (- strand)
Length: 451
>GLEAN_6915 class=GenePrediction position=GCSC_108:889960..889411 (- strand)
ATGTTTTGCTTACGGAGGTAAGTTGCATGGACATATTCCTGAGCACATCGACGTCTTTTCCAGTATCTGATCGGGCACAC
GTGCTGACTCCTTCTCTAGTTGGCTTCCGCTCCTCTTTATCCCCACAAACGCCTCGCCTACGTTCATCTTCCTGTTTTTC
GTATGCACATACTTCCTTAATCGACCGTGCGTCTACTGCTCCTTTCTCCTCCTCATCCTATTTCTCACGAGCTGCAACTG
GTCCGATCGGTGCTTCTTCGACTTCAGCAACGACTGGTTCGAACCCCGAGAAATAACACACTCGCCTGCTGCGATGCAGT
CAACGGACAGCTACAACGGGACCGTCACGGTGGATGACGGATACGGGCCTACGGCTGCTCTCGTGTTTGATATGGTCAAG
ACGACAGCCTCGGCGATGGCGGGCGCAACGGCCGAGAAACTGTCGCACGCTGAGGCGGAATGGACGGGTGTTGGCATCGA
GTGGTTGAGGAGCCTACTCGGACGGAGAGAATGGAGAATAGATTGCATGGACGTGAACATTCGGTTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62