GenePrediction:GLEAN_6917 Details

Name: GLEAN_6917
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:882094..878512 (- strand)
Length: 3583
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:882094..881926 (- strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_108:881859..879002 (- strand)
Length: 2858
Type: CDS
Source: GLEAN
Position: GCSC_108:878952..878512 (- strand)
Length: 441
>GLEAN_6917 class=GenePrediction position=GCSC_108:882094..878512 (- strand)
ATGTCTATCCGCAGCGAGTCGTCGGCGGCCCCGTCAGCGGCCACCTCGCCGACAGACACGCGCGCGCCGGCCAGCCGGCT
CGATTCTTTTCAGGCCCTTGCCGGCGAGGGTCTCGCGGAGAGCTTCCAGTCCACAGACACGATCCGGCGGCGGCCAGACG
CAGGCTATGGTGCGTCTGTCGTCGATGCGGTGCGTGCGAATTTGTCTCGGAGCACGTGACTGATTGTGAGAACAGGAACA
GTTTCGTCTTCGTCCCAGATGCTTCCACCGGCCGCAGCCGACGCGACCACGCCGGCCCACGAGCGACCACAACAACAGCG
GCCCTCGGGCGCGACAGCAAGCCTCTCATCGGCCACGCGCTCACCGCTGCTGGGCCCTGATCGTGGCCGGGGCCGTCCAC
GGAAACCGGCGCTGCCGCGACGCGCATCCAGCAACACACAGGCGCGCCACCGTGGCGGCGTCTTCTCGGTCGACGATGCC
GTCAGCGAGGTTGAGGCCGACGAGGCTGAGCGCAAGTTCAGCCACCCACCCCCGACGCTGGGTACGCGCCGCCGAACGCC
CGGCCAGCTCTCCCTTGGACGGCTGCACGCCGGCAGCCGCGACGAGGGCGTGGACGACGAGGCGTTGGCGTCGCCTGCCT
TTGTGCCAAAGCCGCTCGGCACGCCAGGCGTAGACATGGCGGCATCCAGCATCTTGGAGGAGCTGGGTGACGGTATCACC
GATCTGGACGCGCTGGACGACGAGGTCGAGGAAGACGAGCTGGATCTGGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGG
AGGAGAAGGAAGAGGAGGTGGGACCCAGCTTGTCGGTTTGAACGAAGATGACGACGACGATGACGATGGCAACATTAGTG
ATGCCGAGAGCTTCACGCTAAAAGACCGACAGCAAGCGATCAACGAGACGCACCCGTTTGGGATCCGGCTGTGGAAGCCG
GCACTGTACAAGAAGGACCGGTCGGTGCAGAAGACGGCAGAAGGCGACATTCACTCATCGCCGGGCGGCCACGTCAGCAC
GTGGCTGCTCTTCTTCAACATCATGTGGACGCTCTTCTTTGGCTGGTGGCTGGCGCTGATCGCGTCCACGGGCGCGTTTG
TGTGTCTGCTCTTTGCGGCGGCGTCGAGCGGACGAGAATATGGGCGAGTGCTCTGGGGACTCGCCAGCTACCTATTCTAC
CCGTTTGGCAAGTTTGTCCGGCTGGAGCAGCAGGAGCCGTACCTGGACGAGGACCAGGGCGAGGGCCGAAGCATCAGCGA
GTACGAGCAGTGGCAGAACGGCGACCTCGAGTACGGCCGGCTGTTCTTTGGACCGGAACGCGGCCGCTCCATCATCGGAC
GGTCACGACGCAGCATCGACTCGGAGCGGCCGAACGAGACGGACAGCCTGCTGGGCCACCGGTCGGGCGGGCCCAGCCAT
GGACGCCACGGTAGCCAGAGCCGAGACGAGGACAGCGTGGACGGCGATCTACCACGGATGAAGCGACGGCTCTTTGGTCG
CGGGCAGTGGAATGTCGGACGCGTCATCTTCTTCCTCTTCTTCTACCTGCTGATCACGCCGTCGCTGTTCGTCGCGTCCG
GCATCTGCTGGCTGCTCGTGTTCTGGATCCCGATGGGCCGGGTGACGATCCTGCTGTTCGACCACCTGCGACGCCATCCG
CTGGCGCTGACGTTTGAGTCAGACATTGCGACAGCACGGGCCCCGGCAGCGCCGCAGTCGTCCATCATCGTGTGCACGTA
CCGGGCTGTGGGCCTCAAGTACTGGAAGTATACGGTGGACGGGACGAACATCTTTTTGATCAACCTGATGGCGGTGGTGA
TGTTTGTCATCTTCGACTACATGGTGCTGGACCGCATGCTCGAGGTGGACAACGTCCTGACGTCGTCGGCCTTTCTGTTC
GTGGCCGGACTGCTGTCGATCATCCCGCTGGCCTACTTTATCGGTCAAGCGGTGGCGTCGATCTCGGCGCAGTCGTCCAT
GGGCGTGGGCGCGGCCATCAACGCCTTCTTCTCGACCATCGTCGAGGTCTTTCTGTACTGCGTGGCGCTGCGGCAGGGCA
AGGCGCAACTGGTCGAGGGCAGCATCATCGGCAGCATCTTTGCCGGTATCCTCTTCCTGCCGGGGCTGTCGATGTGTTTT
GGGGCTATCAAGCGGAAGACGCAGCGGTTCAACGCCCGCTCGGCCGGCGTCACGTCGACGATGCTGCTCTTTGCCGTCAT
TGCCGCCTTCAGCCCGACGCTCTTCTACCAGATCTACGGCACCCACCAGCTCAACTGTCTCGACTGTGTCGACAGCGTCG
GCCGGCTGCAGGGCGACGGCGACGGTGACGGCCGCGACTGCCGCCGCTGCTACTTTTCGCAGACGCCGGCCATCGACGAC
CGCTTCTACCTCGAGGCCGTGCGGCCGTACTGCTACCTGGCCGCCAGCCTGCTGTTCCTATCGTACGCCATCGGACTGTG
GTTCACGCTGCGGACGCACGCGGCCGTGATCTGGAACGCGGAGGTCGAGGAGAAGCACGCGTCCGTGCCGGGTGGCGGTG
GCGGTGGTGGTGGTACGATCACGACATTGGGCGAGTCTTCGGGGGCGGACGTGCGCGACGCACATGCCTACCGTCGCATC
ATCGGCCAGTCACTCAAGCAGGCCGGCCTGGCAGCACCGTCCGGATCGCACGGGGCAGCCGGCAAGACGGCAGCATCTGA
CGGCGACAGCCTGCTGCAGCAGGTGGCCGAGATGGCCGGGACGTTGGCCCGGGACGGACGCCAGCCCCGTCGGACATCGG
TGCAGGGCAGCGTGCCGGCGAGCGGTGGCCCTCGACCACCGCTCATCCATCACGAGGACGCTGGTGTAGCAGCTGGCGGC
GGTGCCGCTGGCGGAGACCACACCGGACACGACGCGCCCAACTGGAGCCGGATGAAGTCGTCGGTGGTCCTGATGTGCGC
TACGGCGCTGTATGCGGTGATTGCGGAGATCCTGGTAGACTCAGTAGACTTTGTCCTGGACGGATTCGCGATCGACGAGA
AGTTTCTAGGCATCACGCTGTTTGCGCTTGTTCCGAACACGACCGAATTTCTGGTGAGTGAGAGGGAGGAGACGAGACGA
CGAAAACAAGCTAACAAGACAGAATGCTATCTCGTTTGCGATGAACGGCAACATTGCGCTGTCGATGGAGATCGGGTCGG
CTTACGCGCTGCAGGTGTGTCTGCTGCAGATCCCGGCGCTGGTGCTCTTCTCGGCCGCGTTTCCGGCTGTCGGCGCAGAT
GCAGCACGCTTCACCTTCTCGCTGCTGTTCCCGCAGTGGGACATGATCTCGGTCATCCTCTGCGTCTTCCTGCTGAGCTA
CATGTACGGCGAGGGCAAGAGCAACTACTTCAAGGGCAGCATCCTGCTGATGAGCTACATCGTCGTCGTCTCGGGCTTCT
ACTTTAGCGGCTACACGACCGCGCTCGACATGGAGAGCTCCGGGCTGCGACGCTTCGACACCCTCGGCCAAGACGGCCAG
TTTGTCCGCTATGGCAAGTCGTTCAAGACGGCCGGCCAAGGCCGCGCTGGAGCGGCTTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62