GenePrediction:GLEAN_6918 Details

Name: GLEAN_6918
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:878070..876748 (- strand)
Length: 1323
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:878070..877836 (- strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_108:877771..876863 (- strand)
Length: 909
Type: CDS
Source: GLEAN
Position: GCSC_108:876773..876748 (- strand)
Length: 26
>GLEAN_6918 class=GenePrediction position=GCSC_108:878070..876748 (- strand)
ATGTCGCTGGACAACTACTACCACAACAAGATCGAGGCGATGAAGCTGGAGATCCTCAAGGGCCAAGCCGTACTGCGGCG
CCTGGAGGCACAGCGGAACGACTACAACTCACGGGTGCGGCTGCTGCGCGAGGAGCTCGGGCTGCTGCAGCAGGCGGGGT
CCTATGTGGGCGAGGTGGTCAAGGTGATGGGCACGAAGAAGGTGTTGGTCAAGGTGCATCCAGAGGGCAAATACGGTGAG
TGGGCGTGGATGGGCAGTGTCTGTATGGTGTGGCGTCTGGGCTGGTGCTGACGGAACAGTGGTCGACGTGGCGGACAGCG
TGGACATTGCGAAGCTGACGGTCGGCAAGCGGGTGACGCTGCTGTCGGACAGCTACAAGCTGGAGAAGATGCTGCCATCG
TCGGTCGATCCGCTGGTGTCGCTGATGATGGTGGAGAAGGTGCCGGACAGCACGTACGACATGATCGGCGGGCTGGACCA
GCAGATCAAGGAGATCAAGGAGGTGATCGAGCTCGGCCTGAAGCACCCGGAGCTGTTTGAGAGCCTGGGCATTGCCCAGC
CCAAGGGCGTGCTGCTGTACGGGCCACCGGGCACGGGCAAGACGCTGCTGGCCCGGGCGGTGGCGCACCACACGGACTGC
AAGTTCATCCGCGTGTCCGGCTCGGAGCTGGTGCAGAAGTACATTGGCGAGGGCAGCCGGATGGTGCGGGAGCTCTTCGT
GATGGCGCGCGAGCACGCGCCCTCCATCATTTTCATGGACGAGATCGACTCCATCGGCTCGTCGCGCGTCGAGGGCAGCA
GCGGCGGCGACTCGGAGGTGCAACGCACCATGCTTGAGCTGCTCAACCAGCTCGACGGCTTTGAACCGACCAAGAACATC
AAGGTCATCATGGCCACCAACCGGCTCGACATCCTGGATCCGGCCCTGCTCCGGCCCGGCCGCATCGACCGCAAGATCGA
GTTTCCCCCGCCCAGCGTCGAGGCCCGCGCCGATATTCTGCGCATCCACAGCCGCAAGATGAACCTCACCCGCGGCATCA
ACCTGACCAAGATCGCCGAGAAGATGAACGGCTGCTCCGGCGCCGAGCTCAAGGGCGTCTGCACCGAGGCCGGCATGTAT
GCCCTGCGCGAACGTCGCGTCCACGTCACCCAGGAGGACTTTGAGCTGGCCACGGCCAAGATCCTGAACAAACATGATGA
TAAGGAGGGTGAGTTTCTTTCTTTTCTTTTCTTTTCTTTTTCTCTTTTTCTCTTTTTCCTACATGTTCTCTCTCTCCCCC
ACACGCTAACTCCTCAGTCTCTCTCGGCAAACTCTGGAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62