GenePrediction:GLEAN_691 Details

Name: GLEAN_691
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1464762..1466405 (+ strand)
Length: 1644
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1464762..1464788 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_97:1465454..1465738 (+ strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_97:1465904..1465956 (+ strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_97:1466063..1466405 (+ strand)
Length: 343
>GLEAN_691 class=GenePrediction position=GCSC_97:1464762..1466405 (+ strand)
ATGGCACCTCAGTCAGGAACTACTGTGGTAGGCAGTTCTGCATCTTGGTTTGTGTGAGAAAGTTGGAAAGCTAATAGCAA
GGCCTTTTAGACTTCGACTGTTTTGGGTGTAAGTGGTATTGGCCCCCTTATGGTAACCAGATGCGTAAACTAAACAAGGT
TCTCTGGTTTCATTCAGACCATCGGCACAAGTAAGCTGCATCTTAGCTTTAACTGTTTCGGCGTACTTCATCTGGTCTGA
GCCAGTGGCTAACATCACATCAAAGTGTAAGAGCCTGAACTTTAGCGGCAGTGTCTCGATCTTAACGGCCGGTGTAACGT
TGATAACTAACCGAGGTATCATGCGAGACACAGATTGTGGTGTGTGCAAGTATGTGTCCACGATCTCTCACGTCCGTTCC
AAAGATATGTCTGCTAATCTCTTTGCCTTAGCTCGTGCCTCAGTGAGACTTTTCCCATGCAGTCAACCCCATGTTATATG
ATTTCACGGAAATCTGGCTGACTTTCCAGAATATGGACAAACTGGAAAACAAAAAAGACGGACGGATTGCCCGTCGCGAT
GATGTTTCTCTGGGCCGTGTGTAAGTGTTTCAAGCGCTGCCATTGGTCGAGTTTTGACTAACAGATCCAGGCGGTGTCCC
GTTCGGTACCTACTCTATCATCCAGAACTTCAGCATACCCATACAAATACAGCCGCAGATGTTCATGGCCTTTTGCCTTG
TCAGTTGGGCCCAAGTATTGTACTACGGCAGCAAATGGCCGGTCTGGAAGGCCGTTGCGGCGTATATACTTACCGCAGGG
ATATTTGCCGGTGTAGAGGCGGCCCTAATTTTGACACTTCGGCCGATATACGACCGCGGAGATGAGGCACCGGCACTGGT
GGTCGGAATCCTGGCTTCGATTCTGTTAGCAGCCGGCCTGTTGCCGCCATATGCAGAGCTGTGGAAGCGCCGAGGTCGGG
TCGTGGGGATCAACTGGGTGAGTTATGCTGATTGGATGTGTCTCTGATTATGCAGAAAGCACTGACAGGTTGCAGATCTT
CCTTTGCATGGACTGTAGCGGTGCCATCTTCTCACTCATGGCCTTGGGTAAGGATTCCGTCTGGTGTGCTTCTGTCCCTT
CGCCCCTCTTTTTACTGACCAGATAGTCGCACAAAATTCTTTCGATATCCTTGGTGGGGTTCTGTACATCGTCTGGTAAG
CTTTTACGGATACGGGAAAGTGAGGAGGCTTGTGGAGAGGCCGGAGATCCCAATGTCACGTTCAAGAAAGCAACAAGAAC
CAAGAAACTGACAATGAGAAGTGCGTGTCTGGAGATTGGCATATTCATCTCCCATATTATATGGCGTATCCGCACGCGTG
CCATTCGCAAACAAGCCAAAGCCGACGGCAAGACGTTTGACGATATCTTGGCAGAGCACCGTGCAGCGGGCACGCCGTTT
GCATTTGCAGAGCGCGAAAGCGACGACTGGCTGTCGCCCTCGGCACTGCTCAGGCGCATGCTCGGCAGAAAGCCCAAGGT
TGGTGGCGACGAAGAGAAATGCACCGGCTGCGAGAGCGGGGGCGAGGGTCAGCAGGAAGCGTCGAATGAAAAGGGGCCAA
GTGATGGGGAACGCACCGAAGGGACTGCGCACCAACTGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62