GenePrediction:GLEAN_6920 Details

Name: GLEAN_6920
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:862521..861783 (- strand)
Length: 739
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:862521..862499 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_108:862418..862258 (- strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_108:862177..861783 (- strand)
Length: 395
>GLEAN_6920 class=GenePrediction position=GCSC_108:862521..861783 (- strand)
ATGGCCGGCCTCAGCCCTCAGGTGTAAGTGTGCGACGACCCCATGACGGGGTACCCGCTGTAAACCCCTCGTCTCAATGC
CAATCTAACTCGTGCCCGGATAGAACGAACCTGGTCATCATCCTCGGGATGATGCAGGTGTCGAAGCGGATCCCCTTTGA
TGACCCGGACGTCCTGAACATTGTGCGCATTGGCTACGTTGCCAGCAACCTGATCATCCTGGCTATCTCTCTGTATATCG
GAAGCCTGATCGACAAGAAGAAGGGTGAGTTTGTCCGATATGGATCCAGATCCAGATCTGGCACCACTGGCTCTATGTTC
CTTGCTGACCTGCCCCCCTCCCAGACCTCACCACGCTCAAGTATGTCGAGCCTGCCCCGATGGGCTCGGCCGAGGAGCCA
AAGCTTGTCACCACGACCATCCACGCCTACGACAAGGCACAGCTCAAGACGCTCATGCGCTCGCAGATGATGGGTGTCGC
CATGATGGGCTTTATGCACCTGTACATGAAGTACACCAACCCGCTCCTGATTCAGTCCATCATCCCGCTCAAGGGCGCCT
TCGAGTCCAACCTCGCCAAGATCTACCTCTTCGGCAAGCCCGCCTCGGGCGACTTGAAGCGCCCGTTCAAGGCAGCCGGT
GGTCTGATGAGCAGCCTCCAGGGCGGCTCAGCACAGAGCGACAAGAAGGCCGTCGAAGCCGCCGAGCGGTCTGGCCGGGG
AGGTGCCAAGGAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62