GenePrediction:GLEAN_6921 Details

Name: GLEAN_6921
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:861236..859924 (- strand)
Length: 1313
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:861236..861156 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_108:861084..860451 (- strand)
Length: 634
Type: CDS
Source: GLEAN
Position: GCSC_108:860357..859924 (- strand)
Length: 434
>GLEAN_6921 class=GenePrediction position=GCSC_108:861236..859924 (- strand)
ATGGATCAAACTTCAGCCTCGCGAATACAGTCGGCGGCCGGGCCTAGAATCACCACGCCTGCCGAAACAACCAAACAGAT
TGTCAGTCACGATCAACAGGAGATTAAAGGTCAGCAGGTGCATGCTAACCAGATCGCCGCCTGGCGATGCAGGAGGAGAA
CCGATTCAAAGCGAAAGCCATCCAAGGACAGCGCGACGCTGCCGCCCGGCGCACGAGCAATCAGACCCCTGCAGGCTTCA
TCGCCTCCGACGATGTCCACATTGTAGCGAAAGGGCCTGATGGCCAGAGGAAGCGTCCGCACTCTTCGATAGCAGCCACC
GATCTGCCGTCTACGCAGCGAGATGCCAGCCAACATGATGTCGAGATCCGGCCAGCCCGGAATTTTGCCAAATTTGTGGA
CTACAACTTCAGTTCCATGACGGACACAAAGGGCGGCTTTCTCTCCGCCGAGGACGACCCCTGGAATAAGGCGCTCTCGT
CGGCCGACGGGAAAAACCAAGGCAACGACCAGCGGCCTCAACACATGACGGTCGCCGAGTGGGAGCGCATGCAGGTGATC
CGGAACCTGAAGCGACTGAAGCAGGGTCCGTACGAGCCCGGACTGAGTGTGCTGTCGGAGAAGAAGGAGCAGAAGAAGTG
CTGCGAGTGCGGCAGCTTGGAGATCGACTGGGTATGGGAGGAAGTGCTTCACTGCAGCGTATGCAACGCGTGCAAGGAGA
AGTTCCCGGAAAAGTACAGCCTCCTGACAAAGACGGAGTGCAAGGAGGACTATCTCCTGACCGACCGTGCGTTTCTTACC
CACAAGCTACAGCACATGACGCATTACGCGTTGCCTACGAAATATGCATACTGACTTTTTCTCTACTTTTGGCGTGCAGC
CGAGCTTAAGGACGAGGAACTACTGCCACACCTCTCGAAGCCGAACCCACACAAGTCCCACTGGCACGACATGATGCTGT
TTTTGCGGTGCCAGGTGGAGGAGTACGCCATCAAACACAAGTGGGGGTCCGCCGAGGCCCTGGACGCCGAGTTTGAGCGA
CGCGAGACCGACAAGAAGCGGCGGAAGGAGGCCAAGTTTAAGGAGAAGCTGCTGCAGCTCAAGAAGAAGACCCGGACGGA
GGTGTACCGACGAAATGCAGGTGGGGGCAATGCGGCGCCAGCCGGCCAAGGCAAGGCCATGACCTTTGGTGATGCAATCG
GAAGCGGAGGTAAGCACGTGCACGATTGGGGACGTGCCATAGAGAACGAGGAGGGCATGTCAGTGAAGCGATGCGCCACG
TGCGGTATGGAGGTCGAGGAGCTGGAATTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62