GenePrediction:GLEAN_6922 Details

Name: GLEAN_6922
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:859085..856349 (- strand)
Length: 2737
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:859085..858959 (- strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_108:858885..858607 (- strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_108:858519..856672 (- strand)
Length: 1848
Type: CDS
Source: GLEAN
Position: GCSC_108:856608..856349 (- strand)
Length: 260
>GLEAN_6922 class=GenePrediction position=GCSC_108:859085..856349 (- strand)
ATGAGCTGGGGCGGCCAGAACAACATGGGGTCGAATGCAGGCAATGGCCTAGGCAACATGGGAGGCGACATGTCGGGAGC
GCAGGGCAATGGAAACCAGCCACACGCGACCGAGTACACTCTCCAAGGTGCGTCCTTTTTTCCGGCTTCTACGCTTGGCC
ATTGTGCTGTACTGATAATGTCCCTTCGCGCGCGTGCCAGGTGTTATGCGCTTCCTGCAGACAGAGTGGCATCGCCATGA
ACGCGATCGTAACGCATGGGAGATTGAGAAGCAGGAAATGAAAGGCCGGATAGCTGCGCTGGAAGGATCTGTACGACGAG
CCGACGCCACGCAAAAGGCACTGAACAAATATGTCGCCATTCTGCAGAAGAAAGTCAAGGAACAGGCGGCCCAGCTGAAG
TCGTCTGCTCCAAATGCCGATCCGGCAGAGAACGCAGAGCAGCCAGATCGGGCCGCAAGAGTTTTGGAGAAGCTTCATGG
TAGGTACACTTCACTCATCGTCGTTGGCACCCTTGCGCTCTCAGGGCTCGTTTCATTATCTCTCTGATGTCTAACGCAAA
GTCCAGTCGAAAAAGAGACAGTGCCGGTCGAGGGCGTACCCTTTGTTCCAGCCTCCGATGACGAAAACAGGCGATCCGAC
CTGCGAACGTTTTTGGACCAGTGTCAAGCCGAATTTGCCTACCTCATGATAACGCCCGCCAACCCACTGCCGCCACGAGA
GTCCCCGCCGCTTCCTCCTACCGACGAGCTTCGGGAAGAGGACTATATCCCCATGGGACATCAGCATCAGCAGTCTGAAC
AATACGGCCAGCAGCAGATGCGCTCTTCAAACTTACGACAAGGCCAGGGACTAGCTAGCCATGTGCCGCAAGCGCCAGCA
CCTCCTTCCATGTCTACAGGATATCCGCCCGGCAAGAATGTCGAGCTGCAGCCAACGCCCATGGTCAGGTCCAACGCCGA
AACAGGTCCGTCATTGTATGCCACGGCGCCTCCTGAATGGACACCTCAGACGCAGGTTTCACCAGCGCCGAATCGGTCAG
GCGAGGACTCTGCGGCCGGTGCTGATCTGGCCAGGTCTGGCTTCGCGAATAATTCCGTGATGCCGCCGAATGAGACGACG
GGGGACAAGCCAGAAGCACCCGAGACCGATGCATGGGATTTCAATGACGGGCCATCATCATTCCCGGAGCCGGGCGCCCC
GCAACATGTTACTACTCGGCCCGATACAGACCTCTTCCCTACCGCGGATAACGCATCAAAGTCGCCAAACCGACTTGCGG
GCTCACATCGCCGAAAGGGCAGCATGTCCCGCAGGCGTAATTCGGATCATCATGACCTGTCGTTGAACTCGTCGTCTCAG
AAGGTTGAGAGCGGCAGCTTCAAGTTGCGGTTTGGTCTTCGAGGCCACCTAGACACCGTGCGCTCAGTCATTTTCTCAGG
TGGAGGCAGCCCTGGGGAGCCAGAGATTTGCACGGCCGGCGATGACGGCCTGATCAAGCGGTTCCACATCCCTCGTACGG
CCAACTATATCGGCACTAGTGCTGCATCAGATCTCGATGTGCAGGCAGACTTCACACACCGCGGCCATAACGGCGCGGTG
CTGTGCCTAACGTCATGGTCCCCTTCACCCAACTTCTCGACTGGAGGACGGGCACAGGGCGACGGCTGGATCTTCTCGGG
CGGCCAGGACAATTTCATCCGTGTGTGGGAGCGTGGTCGGGTGGATCCAAAGGCAACGATCGATGGCCATACCGATGCGG
TATGGGCGCTCTGCGTCCTCCCAGCGACGCTGGGCTCTATATTCGGACAGTCTAACCCGTACGGATCGCCGGACCGGATC
CTGCTTGCGTCCGGTGCAGCAGACGGAAGTGTTCGGGTCTGGGCCATCAGTGCGCCACCACAGCTTACGTCGCCAGCCCA
GCCGGCTCCTGCTGCAGGTCGTCGTGCTGGTGGTGGACGCGTCCGAGGAAACTCGATGAGCTCCGGGTCTGCCTTCCCAA
GCAGCCCACAGCCAACAACGGCCAGCAGTAGCCCGTTCGACCACACGTTGGTGCACACCATTCTGCGGGCGAATTCCAAG
GCAAGCCCGACATGCATCACAGCATTGAGCGACAACGGTGCCACATTTGCTGTGAGCTATTCCGATGCGTCCATCATAGT
GTACGACACGCGGCTGGGTGAGGAGATTGGGTCAATGGCCAGTCTCGAGACGTACAACGGAACAATGGCAACGAGCGTCA
ACGCAGTAGTGGCCACAACCGTGGGTCTGGAGCAGCCGCAAATAGGCGAGGAAGACATCGCCGGTGCTGGTGGCCCGACT
GGTGGCGGACGAGGCATGGCTGGATCGGGAGTGGAAGGCGTTATCATCTCGGGACACGAAGACCGATTCATCCGCTTCTT
TGATGCGAACAGCGGTACGCATTACCTGGCCAGCTCACTTGTCTGTAGATTCTGCCGTTACTAATTTTGACTCACAGGAC
AATGCACGTACGATATGCTGGCACACCCGGCAGCTATCTCGAGCCTGTCTCTCAGCCCGGACGGACGCGAGCTAGTGAGC
GCTGGACACGACGCCTCGCTCCGATTCTGGAGCCTAGAGAAGCGAACGTGCACACAGGAGATCACGTCCCACCGGATCAT
GCGAGGCGAGGGCGTCTGTTCTGTGGTCTGGAGCCATGACGCGCGATGGGTGGTCAGCGGCGGAGGCGACGGGGTGGTCA
AGATATTTGCCCGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62