GenePrediction:GLEAN_6923 Details

Name: GLEAN_6923
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:855127..854193 (- strand)
Length: 935
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:855127..855020 (- strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_108:854572..854441 (- strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_108:854381..854193 (- strand)
Length: 189
>GLEAN_6923 class=GenePrediction position=GCSC_108:855127..854193 (- strand)
ATGGCTGGCGGAAAAGGCAAATCGTCGGGGGGCAAGAGCTCTGGCGGCAAGACGTCCGTGGACGGCCCCAAGAAGCAGCA
GAGCCATTCGGCGCGTGCCGGCCTGCAAGTAAGCAATCATGTCTCTTTTTATCTTCGTGTTGTCTTGTCATTTTAATCGA
TCGACTTGCCTCCATCGCGAACTTTGTCAACACGCGTCCCGAATCGTCCTTTTTGCCCCACGTGCCCGTTTCTCTTCGCC
AAGGCAAGACCGGACTAGTGCTTTCAACACCATCGCCTGCTGTCGCGATACGTCTCCCTCTGTGCTGTCCTTTTCGTCCT
TGCCGAGCACCGGGCCGACTGCGGCGCATGTCCCGGACTGCCAGCCAAGGCTTTGCTGCGATGCGCCTCAATGGGTCGCG
AAGATCGGGCCAGATGTGATTGGATGGACGGCGTTATGAAGAAACACGGCACAGAGTGGATGCTTTCTCCCGACAGCTCG
AGGAGGGATCTCGGTCGATGTTTGCCCGTTTTTTCTCGATCGCCTTGCTGACATGCTTCGTTTTCCGCCTCTTAGTTCCC
CTGCGGTCGTGTCAAGCGCTTCCTCAAGCAGAACACGCAGAACAAGATGCGCGTTGGTGCCAAGGCTGCCGTCTATGTCA
CCGCTGTGCTCGAATACCTCACCGCCGAAGTGCTCGAGCTGGCAGGTGTAAGCATCCACCCCCTCATTCCCCCCCTTCGG
CCTAGGCCCTGCTGACCACATGACAGAACGCCGCAAAGGACCTCAAGGTCAAGCGCATCACGCCGCGGCATCTGCAGCTG
GCCATCCGTGGAGACGAAGAGCTCGATACATTGATTCGTGCAACGATCGCATTTGGTGGCGTCCTGCCGCACATCAACCG
GGCATTGCTGCTGAAGGTGGAGCAGAAGAAGAAGAGCAAGGCCATCGAGGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62