GenePrediction:GLEAN_6924 Details

Name: GLEAN_6924
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:847529..846163 (- strand)
Length: 1367
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:847529..847485 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_108:847378..847328 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_108:847247..847039 (- strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_108:846984..846848 (- strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_108:846760..846612 (- strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_108:846552..846163 (- strand)
Length: 390
>GLEAN_6924 class=GenePrediction position=GCSC_108:847529..846163 (- strand)
ATGGACGTGGTATTCCGTAACCTGGCTGGTGGTCGGGGCGAGATTGTACGTCTTTCACGTGCTTTTGCTCCTCTTCTTCC
AACAGTTCTTTTTGCTGTCATTCCTGGCCCACGTACTGACCGTCTCCAGGTATTCCCGCACCCTCCTACAGGGCTCTTGG
AGGAAGCTGCAGTCCGATGATATGCTCATGCTCTTCGCCATGGTAAGCAGAGGATACGATGCATCATTTTTGACGGGCTG
TCCGCATGCACGCCTACGGCACCTACTAACCGCAACTGTTAGGTGACGGATACGATCCTGATGGCCTGCATCAACCTCGT
CGCTACCACCAGCAGCAACCTGATCAACCCTAACGATACCACCCCGCTTACGCCCCAGAACATCAGGGAGCGGGTTCGCG
GCTCGAAGTTTGTCCTGGTCGTCGAAGAGATGCAGATCCTCACCACCTGGACCGTGAAGCTCTGTCTTCTCATCCTGTAC
CACCGTCTGACGTGAGTGTCCCCTGACTTCTGCTGAGCCATGTTGCCGTACTGACAAGCTTGCAGCATGAGCTTGAGACA
AAACTTGGCTGTCAAGATTGTCGCCGGCTACGTCATCGGAGGCTTCATACTTATGGAGGTCCTGTACCTCGGTGTCTGGT
GTCGGCCATTTCACGAGTACTGGGCCGTTCCTACCGATAGCAGTAAGTGGAGCACGCACAAGGCTTCGGCTTCTGCTCCC
AGAAAGGTTCAAGGTCCATACTGACACCGATCAGTCCAATGCTCTGCAGCAACACATCATCTCATTACCAACGCCGTCCT
CAATATCTCCTCCGACATCATGATCATCTTGATCCCAATGCCCGTCTTCCTCAAGGCCGGCATCTCTACCAAAAAGAAGA
TCATTCTTTGCAGCGTCTTCACCATTGGCTTTTTTACTGTACGCACCCATGATGACACAACGGGCCCGAGAAGCAAAGAC
TGACTTTTACGCTGCAGATAATTTCTGCCATTCTCAACAAATACTATTCCTTCCACGACCCCTTTGGGTCCGCCTGGGTG
TTCTGGTACATCCGCGAGTCATCGACCGCTCTTATCACGGCCAATCTCTCACAAACCTGGACGCTCGCACGGAGGGTCCT
GAATTTGACCTCCTTCTCGGAGAACTCGTCCATTTCGCGCTATGGACCAAGTACGGGCTTCCGATCGAGAACCTTGCCCA
GTCATGTCCAAATCTCTGCCGTCAGAGGCGAAGACTCTATGCTGGACCGCTCAAATAGCCAAGAGCGAATCAACCAGGAC
TACCCCGTGCCGCTCAAGATCTACCAACGTCGGGAAGTCGTGATAGAGTACCCGAAGGAGGACGGCGAATCTTCTTTTGG
CCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62