GenePrediction:GLEAN_6925 Details

Name: GLEAN_6925
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:842552..840326 (- strand)
Length: 2227
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:842552..842145 (- strand)
Length: 408
Type: CDS
Source: GLEAN
Position: GCSC_108:842049..841437 (- strand)
Length: 613
Type: CDS
Source: GLEAN
Position: GCSC_108:841357..840443 (- strand)
Length: 915
Type: CDS
Source: GLEAN
Position: GCSC_108:840378..840326 (- strand)
Length: 53
>GLEAN_6925 class=GenePrediction position=GCSC_108:842552..840326 (- strand)
ATGAATGCCCAGCAACCTCAAACCGAGTTCTATCCCGGCTACGGCGGCGGTCCGTTGAGCCACTCGCCAAATTCATCAAG
GCCAGGATACGCAACCACCGTCGGCGTGCCGTCAGCTCTCGGCGGTGGAGGCGGTGGCCGGCGAAACCAGCAGCAGTCGG
TCGATGCGGTGAACCAGGCAGCGGCCCTGTTCAGCGACGATCGCTTTGCCTCCTTTGACGCCCCGTCGCAACGCTTTGAA
CGCGGCACGACCACCCCGTCCTCGCTGCAGAATGCGTTCAGCATGTTCAACGCGCCAAACCAGACAGCATGGGGCTACAA
CGGTGCCTCCAGCGCGGCAACCATGAACGGCCCCATCGGTGACGGCACGCGCATCCGCAATTCGAACCGCCGACCGCCTC
TTCATTCCGTGCGTACCCCATCCTTCCCCTTTATCTTCTTTCGACACGTATTTGTATACGTACGTGCTCGCGCCGAGGAA
AGCAACCGCTAACAGACTGGCAGGAGTGGACAGCAAATCAAAACGAGGCTCCTTTGGGAAACCAGGGCGCTCCCGGCATC
TCCTACTATCAGCAGCAGCAACATCTCGTCGGGCAGCCCATGGGACTCCCAAACTCCGGCTCCCCAGACCCATACAGTGT
TGCACCCCCGACCGTCAACATCCAGGCGTTCGGTCAGCCCGACATGCGTTCTTTCTCTGACAACAAGAAGGACATGGGCG
ACCTGATTCCCACTGCCATTGTTATCAAGAACATTCCGTTCAACGTGCGAAAAGAATACCTTACTTCCGTGATGATCGAG
ATGCATCTGCCCCAACCGTATGCTTTCAACTACCACTTTGACAATGGCATCTTCCGTGGCCTTGCGTTTGCCAATTTTCA
GAATGCCCAGGACACCGCTCTCGTTATCGATCGCATGAACGGGCTGGACATCCAGGGCCGCAAGCTGCGCGTGGAATACA
AGAAGATGCTGCCGGAGCACGAACGCGAACGCATCGAGCGTGAAAAGCGTGAGAAGCGTGGCCAGCTGGAAGAACAGCAC
CGCGGGCCAGCGCATCAGGTTTCCATCTCGTCGTTAGCCACCACGACATCTCTGCAGAGAGCGCCTGTGAACGACAGTAC
GTCCATGTTTTCGCCCACACGGGTCTTGCCCCCTCTCATCTTTGCTCCATTTTCTGCCTATGCTGACTTTCGTAGACCCG
GGGATTTCGGGCCGCGTTGATCTCAATGATCCGCACACTCTGCAGTTCTACCTCGACCTGTACATGTTCCGCAATGATGA
CAACCGAGAAGTTCACATCTTCCCAGCAGATACAGCGCCAGAAGACCGGCGGATGATCCACATACTCGCACATAACATGG
GTCTCGAGCACACATCTATTGGCGAAGGCGAGAACCGGCAGGTGCATGTCAGCAAGTCCAAGTTTGCGACTGGGACACAT
CAGAGTTCTGCCCAGCAGCCGGGCGTGACCCTGGACGGCCATCCGCGCGGACTCAGCCGTGCGGCGACGTACGACTTCAA
CGACCGGCAGCAACATCCGTCTGTGCACGCCGTTGGCCGCGGCCCGACCTTGACCATCCCCAATAGCCCTGAGAATCACC
AGCACGGCGGGCTGAACAGCCTCCGGGGTGTGAAGAGCTTTGCGGATCTGCGCTCGTTCAGCCCCAGCCCGTCTCCTTCC
ATGGTCAGCAGTGGGGGTCTCGCAGCGCCGTCGTCCAACGGCCACGGCGGCGGTGGTGGTGTGTCCTTCATGACGCACTA
CCCCAATGACGGCCCCTTTGGACCCTCTCTGACGACGCCGACAACACCCGGTTCTGGTCTGGCTGCACCGCCGCCGCAGC
CGGCATCCAATGCGGGTGATGCCTCGAGTCTCGTGAACGGACTGGGGTCGTTGGGCCTGGGTTCGTCGTCGTATGACGGT
AACGGCAACAGCCTGGCAAGTTGGTCTCGCGAGACGCCAGGCGCTATCGGCAGCCAGCGGCCCAGTGCGAACGGCAACGG
CGGCAACAGATCAATTCCGGAGCGGCAACCGCGCGGTCCAGGCAGCGACTGGGAGAATCCAAACGGGTTCTCGCGCGGTC
GCTCAAACGGTCACATGCATCGTGGCAGTGGTAAGTCTTGCACGCCTGATAAACGTTGTGGAACCTCGCTGAACTCTTTC
TGACCGCTCTACAGATTCTTCTGATAGCCGTCTGGGCGCCACCCATGGGTCTGCCGCGCTCTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62