GenePrediction:GLEAN_6926 Details

Name: GLEAN_6926
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:828381..824346 (- strand)
Length: 4036
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:828381..827761 (- strand)
Length: 621
Type: CDS
Source: GLEAN
Position: GCSC_108:827705..824346 (- strand)
Length: 3360
>GLEAN_6926 class=GenePrediction position=GCSC_108:828381..824346 (- strand)
ATGCTGAGCTCCATTTCTTCGCGTAACAGCCTCTCCGTGGCTCCTCTCGCCATACACAAAACCGACGCCGCGGCAGTATC
TGGCGACGATGCCTACTTGACGGCCCTCCACAACACCACCTCTTTATCATCGTCTTCCCTCCTCTCAGCACACGGGGGAA
ATCTTTATGCACACTCCCAGATGACGCCACCAGCAACCCCAAATGGCTCGCAGGAGGACCTGTCCCACAACAACAATAAC
AACGGATACATGCACAGCTCTCTGTCACAGCCCGATCCACCGCCAGTATTTCACAACTTCTTGCGCGCTTACTATGCCTT
TCAGCCTAGCTACTCGCCTGCCGACTCGACCGTCACATTGCCGATGAACGAGGGCGATGTCATTCTGGTGCATTCCATTC
ATACCAATGGCTGGGCTGATGGCACCCTCCTTGTGTCTGGTGCACGAGGCTGGCTGCCCACGAACTATTGTGACGCCTAC
GAGCCAGACGAGATGCGGAACTTACTTAATGCTCTGCTGAACTTCTGGGATCTGATGCGCAGCACCACCGTCAACGACAA
CGAGATTTTCGGCAACCAGGAGTTCATGAAGGGCATTATCGCTGGCGTTCGGTACCTGCTGGTATGCTTTGCCGACTCAT
TGTCTACCTTTTCCAGTCTCATGACTAACGTTCCAGGAACGCACCGAATGTCTGACACGCGAGTCGCCTCTGATTCAGCG
TCACGACGGTTTGAGGCGCAATCGGAAATCTCTGCTGTCCGAATTGTCGTCCCTCGTGAAGTCGGCTAAGCGGTTGCAGG
AGTACCAGCGCTTTCCCGACCCAACCGAGAATGTCAACAACATTGTAGACGAGATGATCCTAAAGGCGTTCAAGATCGTC
GTCAAGGCTGTTCGTTTCTGCGACGTCATCGAAGAGGACCGCCAGCAATATGCACAGGCCATCGCTTTGTCTGCCTCTCA
ACATCTCATGCAGCCGATAACATTGATGACTCCAGTGCAGGACGAGAAATCCATCCCACCTACGCCACCCGCCGACAGCA
TCACGTTCGATGGCCGGAGGAGGGGGCTATCGCTGTCCGCATCCGATCCCTTGATCGCCAGCGGGGCATATGCAGCCTCG
TCGCTTACAGTCTCTGGAGCGCCTGTTAACAAGCGCCTCTCCAGCTTGACGGCGAATTATCAACACCGGCTGTCACAATC
CGGAATTAAGAGCTCTTTGGTGAACAACAACCGCCTGTCCTCGTCTAGCATGTCTCACCGCGTTTCTTTGGCGGGTCCCT
CGCCGTTGTCACAGGCTCACAATTTGGTCTCCCACCGGCTGGGTGACCGTCATGACACATTCTTGTCTTATCTCGGATCC
TTCATTGGCCGGCTGCACCTCCATTCACAGTCTCGGCCGCAGCTGGCCTTGGCGATCAAGCAGTCGGCCACATCCGGGAG
CCAATTGTTGGTTGTGGTCGACGTGGTATCAGGCCACGACTCGCTGAGCCGTGAGATTCTGCACAACTCGCGCGTTGCCA
TGTCTGACCGCATCCTCGAGCTGGTGTATCTTGCACGGGACATCCTGACTAATCAAGTAACTGATGTTGACGATGTTATC
GTCCCGCATGACAACGGTCGGCTTCTGACCGCCGCAACAAACTGCGTGAAGGCCACAGGAGAGTGCGTGGCGAAGACGAA
GTGGGTTATCGAGCGCATCGGCGATTTTGAGTACGAATTCGACGACATCACACTGGCTTTTGACGTTGACCTTTCCGTCT
TGGACATTTCGTTTGCGACTGTAATGTCTGACGCCGCGAGCTTGGCGGCAACTGACACCGTGTCGATCAAGACTCTTATC
GCCCATACCAACGAGACCGAGCAACAGACGTATCCCGATGTCGGCTACGGTGACGCTTCAGATTCGTTCACGCCGGCCAT
GTACGATGCACAGGGGCCTGCAGCGATGGAAACGCAATTGCCCTCAGTCAGCCCGATACCCTATGTCGACAACATGGCTG
CCCGTCGGCTGTCCTCTGCGGTACCTCACCTCAACAATCTTTCTGTTGATAAGCCGCTCCCCGAAGTCCCTCAGGTTACC
TCACCGATTGAAGATGTTAGTCAGTCCCGGCAGTACTCTGCGGCGTCTCGACCTGTCTCCTATGCCATGGAGGATGTCTC
TGCGATCACCAGCGTGACCTCGTCTGTGTCATCCACCCAACCGGCGCTTCCGCGCCTGCCACGAATGTCGACGTACATAC
CTCGCGAGGGTGACAGCCCGGTCGAGCAGGCAACCACTAACGAAGGCGAATTCACGTCGTCGTTCCACTCCGAGAGTCTT
ACCGTGAACAGCTCCGGCACGACAAGCACTTACGCGAGCCGCAACTCCGAGTCGAGCTTGGTGTCGAGGACTTCAACACG
TGCTACCACGCCAGACAACACGCTTGTGAACCAGCCGTCGCTATCGGAGTTGAGCACGACTGCAAGCTCGACTCTCGTCG
AAGAAGCCGAGGAGGAGGTGGAATCGAAGCTGCTCGAGCGCACATATGCGCATGAGCTCATGTTCAACAAGGAGGGCCAG
GTCACTGGCGGATCGCTGCCAGCCCTCGTCGAGCGCCTGACAACACACGAGTCGACGCCGGATGCTATGTTCGTGTCGAC
GTTTTACCTGACTTTCCGCCTCTTCTGCAGTCCGGTGAAGCTGGCAGAGGCGCTCATCGACCGCTTTGAATATGTTGGCG
AGTCACCCCATATGGCAGCGCCCGTTCGGCTGCGTGTTTACAACGCCTTCAAGGGCTGGCTTGAGTCGCACTGGCGTGAC
GAGCTGGACCGCGAGGCTCTCGTGCTGATTGAGCCTTTTGCCGAGGTCAGATTGAGCAGCATGCTCCCGTCGGCCGGTCG
GCGGCTCTTGGACCTGGTTGAGCGCGTGGGCGATACTGACGCCACTCTGGTTCCGCGGCTGGTGTCGACCATGGCCAAGA
CGAGCACTTCCATTCCGCAACACAACGCGGTGGACTCGCCATTTCCGACAACGCTCATGTCCAAGGCGCTACAGAACGGT
CTGGCGAACTGGAAGATGGGCGGCAGCATCCCGTCGATCATGGACTTTGACCCAACGGAGATGGCCCGGCAGTTGACGAT
GCGGCAGATGAACATCTTCTGTTCGATCATGCCTGATGAGCTACTGGGCTCGCAGTGGATGAAGAAGGGCGGCCTCGGGG
CACCGAACGTGAAAGCAATGACGGCACTGACGACTGACCTTTCCAACCTGGTTGCCGACACCATCTTGACACACGCTGAG
GTGAAGAGGCGGGCGGCCGTGATCAAGCAGTGGATCAAGATTGCGCACCAGTGCGCCGAGCTGCAGAACTACGATGCTCT
CATGGCCATCATCTGCAGCCTGAACAGCTCGACGATCGCCCGTCTTCGCAAGACGTGGGACATCGTGTCGCAGAAGCGGC
GTGACATGCTGAAGACGATGCAGGCGATTGTCGAGCCGGCACAGAACAACAAGGTCCTCCGTGGCCGGCTCAACGGCCAC
GTGCCGCCTTGCCTTCCGTTCCTGGGAATGTACCTGACGGACCTGACGTTTGTGGACATTGGCAATCCGGCGACGAAGCA
GCTTCCGGGCCAGGATGGAGGTGACCGCAACGGCAACAGCAGCGACAACGAGAACGGAAGCGGTGGCGGTGGGCTGACGG
TGGTCAACTTTGACAAGCACATGCGCACGGCCAAGATCATCGGCGAGCTGCAGCGGTTCCAGATTTCGTACCGGCTGACG
GAGGTGCCGGACATCCAGGAGTGGATCGGAGAGCAGATCAGCCGGGTGCGCGAGATGGACAAGACGCAGGGCGACAACGT
GCAGGTGTCATACTACCGGAAGAGCTTGCTGCTGGAGCCGCGTGAGGCGCAGGCCCAGATGCTCAAGTCGATGGTGGATG
CCGGCAGCGCTGCAGCAGTGGCGGGAGCATTCACGATCAAAGAGGCAGGCCGGGCCGATCTCTTCGCCTGGATGCGTGGC
GGATACAACGCTGCGAACGGCGCGAGCAACGTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62