GenePrediction:GLEAN_6929 Details

Name: GLEAN_6929
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:816216..815283 (- strand)
Length: 934
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:816216..815937 (- strand)
Length: 280
Type: CDS
Source: GLEAN
Position: GCSC_108:815773..815283 (- strand)
Length: 491
>GLEAN_6929 class=GenePrediction position=GCSC_108:816216..815283 (- strand)
ATGAGCGCAGATTCCATCAAGAAAGTGCCTGGTCCGTGGTCCTGCAAGGCCCAGGTCTACAACATTCCCTTCATTGTCTC
ATCCACACAGGTGAAAGAAGCTTCTGACTTACTGTTCTCGCCGCTCGAGGCAAAGTCGTTCTTTGCCTCGGCAGAGGCTG
GCCTGCCCACTGGAGGATCATGTTCCATTATGATTGTGCGCTATTCAGAAACACCTGTTGGCCCATACGACGAAATTTTG
ATCCTTCCGGGGCAATACACATATCCCACGGTAGGGGATTGTAAGACACAGTCAAAGCCGAGGCAAGAAAAGGCACTCAG
AATCACAAGGATTTATGTGTCGCAGAAGGACACAGCCTGGAATGGGCGGTATAGTATGCTACCGTCACGACCCAGGCTCC
AAAGTGTGATGCCTTGAAGCTGACATTCTTCGGCTCGTGGCAGACTGGAACATTCCAAAGCATCTTGCTCGGTTTGACTG
GAAGGACCTTTCTGGTGGCGCGGTCCAGCTAAAGGTCTTTCCTAGTGACACAGAGCAGCGACAGGATGAGCCTTTCTTCC
AGATGACCTTTAAGACGGTGCCCTTCGTGCCGGCCTTTCCCGCGTCCACTGTCTTGTACAAGCTGATTGGCATCCAGCCA
ACCCTCGTACAGCCTCCGGTACCGCGTGGGGCTGGGGCTGGCAATGATGAGCTTGTAGGGACCGATCACTGGTCCAAGAC
CGATCTTTACCAGTACTCGCCGCGATCTCATGTGGGATGGTTTGACCTGAGTCAGAAGAACGAGCAGGGTGTGGTGGTCA
CAGGGCACGAAAACTTTTGGCCTGGAGGCGGAAGATGGAGAATTGGTGTTCGGATGGATACCATTTCCTTTGATATCTCC
GCCGGAGAGCACTGGAAAGCTTTGGATATCCCAACCATTGTCTCAGAGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62