GenePrediction:GLEAN_692 Details

Name: GLEAN_692
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1469717..1470787 (+ strand)
Length: 1071
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1469717..1469739 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_97:1469801..1469832 (+ strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_97:1469993..1470072 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_97:1470153..1470175 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_97:1470233..1470261 (+ strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_97:1470363..1470787 (+ strand)
Length: 425
>GLEAN_692 class=GenePrediction position=GCSC_97:1469717..1470787 (+ strand)
ATGGCCCCTCGATACCAAGCGTGGTGAGATCTTGTCGTTGTCGTGGCTGCATGCTCCTGGGACCGTATCACTAATACTTC
GTAGTCGCGAATGTCATGTTGTCGTTTTAGGCGCAGGTGTGTTTTCCCCACGTATTCCCGTTTCTGGATAACATCTCTTG
CAGCTCCGTTGCGTGCTAACACCAAGTGCTAGGTGGCGTAGGAAAGAGTTGTCTCACAGGTTAGAACGCTTTTGATACAT
GACATAGACCTGATCGTCTTACTGACAGTCAAACAGCCCAGTTTGTCCACAATCAATGGATTGAAAGCTATGACCCTACC
ATAGAGGACTCCTACCGGACACAGGTCACTGTTGACGTGAGTCATACCTTCTGAGAGACATCATATCTCCCCCCTAAAAG
CTGTATGAAGAAGAGGCTGACCGTCATGCCTTATAGGACCGGCAAGTGATGCTGGAGATGTAAGGCTCTCTGCCACCACG
ATGATCGTGTGTAGATTCGACTAACCCTCTCCCTAGTCTTGACACAGCTGGCACTGAGCAGTTTGGTATGCCTGACCCCA
ACTTGACCGTGGGCAACGACGGAAGCGCATTCTGCGAGCGCCTGGGGTGACTCATTCGCTAACATGTTTCTTGTCCCCAT
TGCTAGTCGCCATGCGGGATCTTTACATGAAAACCGGCCAGGGGTTCTTATTAGTTTTCAGCATCACATCACCCTCGTCC
CTCACGGAGCTGACAATGCTGCGTGAGGAGATCATACGCATCAAAGACGACGAGAACGTCCCCATTGTCATTGTTGGAAA
CAAGGCTGACCTTGAGGACCAGCGAGCGGTGACACGAAGCAAGGCTTTCACATTGTCACAACGGTGGAATGCCCCGTATT
ACGAAGCTAGCGCGCGGACACGGACCAACGTCGACGAGGTGTTCATCGACCTGTGCCGGCAAATGCTTAGGAAAGACGAT
ATCAGTCCTGCCCAGGCCTACGAAGACGACTACAAGTACGAAGGAAACGCGTCTTCGGAGAGGAAGCGACGCCGGCGTCG
GCGAGACGGCCACCGTTGCACAATCTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62