GenePrediction:GLEAN_6930 Details

Name: GLEAN_6930
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:804883..803195 (- strand)
Length: 1689
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:804883..803746 (- strand)
Length: 1138
Type: CDS
Source: GLEAN
Position: GCSC_108:803694..803195 (- strand)
Length: 500
>GLEAN_6930 class=GenePrediction position=GCSC_108:804883..803195 (- strand)
ATGTCGGCAGCCACGGAGAGACAGCCGCTTCTGCGGGACAACAGCGGCTCCAGCAGCGTGGCTGTCAGCGCGTCGCCGTC
GCCGACGCTGGTGGCAGCGGCATTGGGCGAATGCGGCGGCTTCAACGACGACGAAGGCATCACATCGGTGGACCCGAGAA
TTGGGTTCAACCCCAGCGGTGACCCGGACAACCCGCGCGACTGGCCGGAGGCGTTTAAATGGGGCATCGTGATGCTTCTA
GCGGCCATGGCATTCACAGTGACGTTTACGTGCATCTCGATCGTGCCGCTGGCCGCGCACATTGTGGAGGAGCTGGACGG
CCTCTCGGGCGACTCGCGCAACGCACCATCGTCTTCGGGCAGCACGGCCAGCGTACTGCTTGTGACGATCTGGGAGCTCG
GCGAAGCAGCCGGTCCACTGGCTATTGCGCCGCTGTCGGAGACGGCATCATGGGGCCGATATGCGGTGCTCAATGCGGCC
ACGTTGCTCTTTGTGGGTGCGACGGCGGCGGCAGCCATGGCCAAGTCGACGTCGCTGTTCATTGCTGCGCGCGGGCTCAC
GGGCCTCGCCGTGGCCACCAACGTGCTCGGTCCAGCCATCATCGGCGACCTGTTTCCACCGGCTCAACGCGGCTCGGCCA
TGGCGATCGTGCAGATGGCGCCACTACTGGGCGGCGCTGTGGGCCCAGCGATCGGAGGGGCTGTAGCCGGGACCTGGGGC
TGGCGTTCGGTGCTGTGGCTGAGCGCCGTGTTGGCGTCGACGTGTGCGGTGCTGTTCCTGGTGGCGTTCCGCGAGACGTA
TCCGCCAGCAGTGCTGCGCCGACGGCGGCTGCGGCTCGAGCTGACCGACGGCAAGCTGACAACGGCCAGCCTTGAGAGCG
GCGCTTTGCTGACGACCACCCTACTCGACCCAACGATGTCAACACCGGCGAGCTCCGTGTCCGGTCTGCGACACATGCGC
GACGCCGTTCTTCGGCCGGCCGTGGTGATGACCAACTCGATCGTGCTGGCGTTGCTGTCGCTGTTTGGTGCTGTCGTGTT
CTCGTACTTTTACACCATGTCCGTGTCGTTGCCGCATATCCTGGAGACGCGCTACGGGCTGTCATCTGCCGGGACAGGGT
CTGCCTTTTTGGCGTTTAGTGAGTTGTCCTGCATTGTCTTCTGCCTGGCTGCCTTCTGACAAGTTTCAGGCCTTGGCGCT
GCTATCAGCGTGATGATCTGCAACCAGACGCTGGACCGCGTTTACGTGTACCTCACAAAGAAAAGCGGGAAGCCGCACGG
TCGACCCGAGTTCCGGCTGCCGATGACGATTGCGTGCGGCTTGGTGTTGCCGGGGGCCGTGGCCAGCTATGGCTGGTGCG
CTGAGCTGCACGGACCGTTGCCGGTAATGCTGGGAACGGTGGTGCTGCTGGGCACGAGCCTGCCGCTGTCGTTCATCCCG
CTGGCGTCGTACGTGGTGGACGCGTTTGGGCTGTACGCAGCGTCGGCGATGACGGGCCTGATCGTGTCGCGCTGTCTTTG
CGGAACATTCCTACCGCTGACAGTGGTGCCGCTGGTGGACGCTTTGGGCTACGGCTGGGGATTCACGGCACTGGCGTCGG
TGAGCCTACTGCTGGTGCCGCTGCCTCTGCTGGTGATGCGGCATGGCGAGAAATGGCGGCAGCGGTCCGAGTACACGCGA
AATGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62