GenePrediction:GLEAN_6931 Details

Name: GLEAN_6931
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:800831..799731 (- strand)
Length: 1101
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:800831..800714 (- strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_108:800653..799731 (- strand)
Length: 923
>GLEAN_6931 class=GenePrediction position=GCSC_108:800831..799731 (- strand)
ATGACGAAGCCTGACAACCTGCCGGAAATGGAGTACCGGTTCCTCGGCAGATCCGGCCTCAAGGTGTCTGCCCTGTCTCT
GGGCGGGTGGCTGACCTACGGTGGTCACGTCGACCGCGGTGCGTAGGGTGTGGTGTGACGAGCTCAGTCTAGAGCGAGCG
AGCGGCTAATGGCGACAGAGAGCACGTACGCCTGCATGAAGGCGGCGTACGACGCAGGCGTCAACTTTTTCGACTGCGCC
GAGACGTATGCAGAAGGCGAGAGCGAGCGGGTGATGGGCGAGGCGATCAAGAAGTACGGATGGAAGCGCAACGACCTGGT
GGTCTCGACCAAGATCTACTGGGGTGCGGCCTTTGGCAGCAACCGGGCCAACAACGTGGGCCTGTCGCGCAAGCACATCA
TCGAGGGCTTGGACCAGTCGCTGGCGCGGCTGCAGCTGGACTACGTCGACCTGGTGTATGCGCACCGGCCGGACCGGCAG
ACGCCGATGGAGGAGACGGTGCGGGCCTTCAACCACGTCATCAACCAGGGCAAGGCGCTGTACTGGGGCACGTCCGAGTG
GAGCGCGGATGAGATCGCGCAGGCGTGGCGCTACGCCGACCGGCTCGGCCTGATCGGACCGCTGATGGAGCAGCCCGAGT
ACAACATGATCAAGCGCGAGAAAGTCGAGGCCGAGTTCGCCCACCTGTACCGCGAGGTCGGACTCGGCCTGACGACCTTC
TCGCCCCTGCGCCTCGGCCTGCTGAGCGGCAAGTACCGCGACGGCGTTCCGCCCGACTCGCGCCTGGCCCAGACCCAGGT
CGAGTTCATCGCCGGCCTCTGGCAGCGTCTCGGCAAGGACAACATCGACGCCCTCGTGCAAAAGGTTCGCCTGATGGAGC
CCATCGCTGAGCGGCTCGGCACCACCCAGAGCGTCGTCGCCCTCGCCTGGGTCCTGCACAACCCCAACGTCAGCTCCGCC
ATCATGGGCGCCAGCCGCCCTGAGCAGGTCTATGAAAATATCCGCGCCGTCGAGATCTACAAGAAGCTCACGCCCGAGAT
CATGGACGAGATCGACACCATCCTGAACAACAAGCCGCCCGTGGCGACTGCGCGGTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62