GenePrediction:GLEAN_6932 Details

Name: GLEAN_6932
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:799426..796270 (- strand)
Length: 3157
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:799426..799295 (- strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_108:799216..797950 (- strand)
Length: 1267
Type: CDS
Source: GLEAN
Position: GCSC_108:797887..797620 (- strand)
Length: 268
Type: CDS
Source: GLEAN
Position: GCSC_108:797272..796270 (- strand)
Length: 1003
>GLEAN_6932 class=GenePrediction position=GCSC_108:799426..796270 (- strand)
ATGCACGGGACCTTTTTCGGAGTCCTCCGTCGCTACAGCTGTCGCATTGGTCGGCCATCCATCCGCAACCTGCATCGGAT
CAGTGAAGCCAAGGCGACGATATCCATGGCGTCCACCACGCCGACGTACGCGGTACGTCCGGGAAGAGGGAACCATGTGC
AGATGGCCGGTCGGTCCTGGGCTGGCACGGACGCATGCTGACCACCACAGGATGCTATCCGGCTGCTCAACTCGACGCAG
ACGGGCTATAAAACGCTGGAGCAGCGGCGGCGCGATGGCTTCAAGCTGGACGACCAGGACCCGATCGGGCAGATGAACCG
GTGGCTGGGCTACATGGGCTATGCGCCGGCGGATCTGAACCGGCTGAACGTGGTGCACGTGGCCGGCACCAAGGGCAAGG
GCACGACGTGTGCGCTGACCAACTCGATCCTGGAGCGATACCGACAAGGCGACCGGAAAGGCAGTGCTGGTCCGCACAAG
GTCGGCCTATTCACGTCGCCGCACCTGGTGGCCGTGCGCGAGCGCATCCGTATCGACTCGGCGCCCATCTCGGAGGCCGA
TTTTGCGCGGTACTTTTTCGAGGTCTGGCAGGCCCTCGAGGCTGGTGATGCGGACGCGCCCAGGCCGTCGTACTTTCGTT
TCCTGACCCTGCTGTCGCTGCACGTGTTTGTGCGCGAGGGCGTCGACGCGGCCATATACGAGGTCGGCGTGGGTGGCGAG
CTTGACGCGACCAACGTGTTTGTCGCTCCGGCCGCTACGGCTGTCTCGACGCTCGGCATCGACCACGTCGTCACGCTCGG
CCATACTATCGACCGCATCGCCTGGCACAAGGCCGGCATCTTTAAGCCGGGCTGTCCGGCCCTGACTGTGCCCCAGCAGG
ATGATCCGATCCCGACGGACGTGCTGCGAGCTCGTGCCGCCGAGCGCCAGAGCAGCCTCACGATCCTGCAGCCGGACTGC
TACGAAGCCGTCTTGCGTGGCGTTCGCATCACGCCCGACGAGCCGTTCCAGCGCAAGAATGCCGCCCTCGCTGTCGCTCT
GGCCGCTACCGTGCTTCGGCGGCTCGGCGTGGACGACGGCCGGATTGCCCTCGAGGCCCTGGGCCTGACAGAAAGACATG
CGAGCAGCGATTCGACCGATGGGGCCGATGGGACCAAACTCCCCCAGCCGTTCGTCGACGGACTCGAAAACGTCGTCTGG
CGCGGCCGCTGCGAGAGCAAGACCACCGACCGCCAGCGCTGGTACCTCGACGGCGCCCACAACCACCAGAGCCTCGACGT
GGCCTGTCGCTGGTTCAGCCGTGCGGTGGCGACCGACAGCACGACGCCCACCATCCTCATCTTCAACCAGCAGTCTACGC
GCGACGCCGTCGACCTGCTGCGTGTCGTCCATGAGACCGTCTACCGCGCGGGTGTGCGCTTCCAGCATGCCGTCTTCTGT
ACCAATGTCACGTACAAGGACAACTCGTGGAAAGTTGGTGTGTATATTACTAAGCAAAGTGTTTTGTATTTTCATATGCA
TCCGAAAGCTGACCACCAGACTTTGTCAACAACAACGTTGACCCGTCCGAGCTCAAGAGCCTGTCGCTGCAGCAGACACT
CGCAGACTACTGGAAGACGCTCGACCCAGACACGGACGTGGCTGTTGCGCCGACGGTCGAGGACGCCGTCGACCGCGTTC
GCGCTATTGGAGGCGGCCAGGTCGACACCCGCACGCTGATCACCGGCAGCTTCCACCTGATCGGTGGTGCTCTCACCGTG
CTGGAGGGCGGCGAGGCGTTTGCCCACGAGAGCATCTCGGCCACGTTGTAAACAGGCTTTCTGCAAGGACGAATATAGAC
TTTCAACAAGACGGCAACGGCAGATACAACTTGCTTTTTATAGTTTCAATAAGCGCTTTTTTATCCGGCAATCTTTTATA
CGTCTTGTCGCGTAGCGTTAAACCCCTTTGTTCAAGACGAGCCGCTGCTTACCAACTTGCCTGCTCTGTCCCAATGTTGC
ACCGCTTCTAGACTGGTGATGCAAACCCCACCGTCTTAAGCAGCCGAGATTATCCAACTAGGAGCTGCATGGCCAATAAT
TGCTTACTGAGACCGGGATAATTGATCGGCAAAACCAGACCAAAACAACCGACAAAAACAACCGCCGAAACCAGTGCGGA
CGAGAGCACGTTCTCACACATTCTCCCCCACGAGAACAGCATGGATCGGCTATATCCCAAGGCGACGCAAAATCGGCTGC
GCTTCCACGATCCAGGCTTCAGCACGGTCATCGTCGCCTTTCTGCGCGCTGCCGGTCGGAACTTTCTGCTGCTCCAGCTG
CTCTTCCTCGGCCTCTTCGCCTACATTTTCGGCTCGCTCTTCCAGCAGTCGGCCCACGGCCACAACCTGACCATTGCCTT
TGTCGACTACGATGGCGGCTCGATCTCCTCGCCCATCGGCCAGGCCGTCCTCACGGCCTACGCATCGCTGGCCGGAACCG
CTTTCCCGACCCTGATCGAGCGCGCCCGTGACGACTTCCCGCTGCCGGCCACGGACCTGCGCCATGCCGTCTGTCGAACG
GACTACTGGGGCGCCCTCTACGTGTCGGCTGGCGCATCTGGTCGACTACAGGCCGCTCTGAACAGCAGCAGCAGCAGAGT
CTCGTCCAACTACAACCGCAGCGACGTGCTCTTCTACATCTGGAACGAGGCCCGCTATCCGGTCGTGGTCGATGCGCTCA
TCGCCGGCAGCATCCAGACGCTCGCCCAGGCCGCTCGCATCGTCCTCGCTGCCAACGGCACCGCCACCGACAGCGATGGC
ATCATCCCCTGGCCGCTCGGCAGCCCGGCCACCGTCGACGTGCTGGCCAACCCCTGGACTCCCGTGGCCGTCGACATCCA
GCCGACGCCACAGGGCTCGCGCGCCATCTACAACACGCTCGTCATCATCCTGATTTTGATCCAGGAATTCTTCTATCTCG
GCATCATCAATGCCCTCACTACAGCCTTCCACACCTATAGCAAGATCCACGCCCTGCGCATCCTCCTGATCCGCACCCTC
AACGCGCTCAGCTACACCCTCATCGGCGCCCTCTGCACCACCGGCGCCATCTGGGCCTTTCGCGACCACTGGGACGTCCA
GGCCCTCCAGTTCGGCGCCTCCTGGATGGTCCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62