GenePrediction:GLEAN_6934 Details

Name: GLEAN_6934
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:794987..793834 (- strand)
Length: 1154
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:794987..794941 (- strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_108:794885..794258 (- strand)
Length: 628
Type: CDS
Source: GLEAN
Position: GCSC_108:794201..794129 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_108:794072..793834 (- strand)
Length: 239
>GLEAN_6934 class=GenePrediction position=GCSC_108:794987..793834 (- strand)
ATGGCAAAACCTGTTATTGCTGTGGCCGGAGCTGGCGATCTTGCCAAGTAAACATAGGCCATTCTCGTTATGGAACAAGA
CACAGGTAGTTAACAGTTCCAGGGTCTTCCTCGAGGAATCATGGGCCGACGGCACGTTTGATGTCGTTGTGTGCACGAGC
AAGGTCAGGATGGCTTCCAGACACGCGCAGAACAAAACGCATACTGACCAGAAACAGATGAAGGAATGGTACGACAAGCC
GAATATCAACGTCGCCATCACCGACTACTCGGTCGAGTCCATGACGGAGCTCCTCAACTCCACCGGCGCCGTCGCCCTCT
ACGTCTTCTACATCACCTTTGACTACCCTGTCTTCGTCAAAGTCCATAGCGACCTGCTCGACGCCTGCATCGCGTCCAAG
TCGTGCAAGCGCTTCGTGCCGTCTGAATGGTGCGGAAATGCTCTGGACTTTCCCCGCACGCCGCGCTTCTACGGAGAGAC
CCGGCTGCCAATCCGCGAGAAGCTGTGCGCACAGACAGAAGTCGAGTGGACCGTTATCTGTCTCGGCTTCTTCATGGACT
ACGTCGTCCCGTCCCACCAGACATACCTCAAAGACTACGGCGAAATGGACCCGTGGCATCGTGAGAAGTGGGTGGCCACA
CTGATGGGGACGGGAGACGAGATGGTCGGCATGACCTCGAGCCGTGACGTCATGAAGGCGGCCATTGAGATTGCCAAATT
GCCTAAATGGGTATGTCTTTGCTGCACGATCGACCACCTGATAGCCAAGGCTGACTTGTGCACTAGGAAAATTATTTCTT
TATTGTCGGAGAGAACACCACCCTCAACAAGGTGACCAAGCAGATGGAAGAGTTCTATGGTAAGCAGCCTCTATCTGTTC
TGTCTCTTTCGGACTCGGGCTCTGACTGCGCACAGGCCGCAAGTTCAACAAGATACAATACAAGACAAAGGAGTATACAG
AGGCAGAGATGGAGATTAACAAGGATGATGTCGAAAGGCAGAGCGTACTGGATGTATTTGAGTGGCTCTACAATGGAGCT
ACATACATGCCAGAGGAATACTACAAGCCACAGAGAGAAAAGTACTTTACGAATGTCAAGTTCAGGACTGTAGCGGAACT
GCTGGCAGACTCCAAGGTGAAAGAATTGGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62