GenePrediction:GLEAN_6935 Details

Name: GLEAN_6935
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:783751..782624 (- strand)
Length: 1128
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:783751..782919 (- strand)
Length: 833
Type: CDS
Source: GLEAN
Position: GCSC_108:782822..782624 (- strand)
Length: 199
>GLEAN_6935 class=GenePrediction position=GCSC_108:783751..782624 (- strand)
ATGGCACACTATCCCACGCGCAAAATTGGCGACACGCCCGTTTCCGCCATCGGCCTTGGCTGCATGGGTATGAGCGTTTC
CTACACATCCTTTGGCGGCATCAACGACGAGGAATCGCTGAAGGTGCTCACCCGGGCCGCCGATCTCGGTGTCAACTTCT
GGGACACGAGCGACGTCTATGGCTTCGGCAAGAACGAGCAGCTGCTGGGCCGCTGGTTCCGTGAGACCGGCCGACGGAAC
GAGATTTTCTTGGCCTCCAAGTTTGGCATCCTGCATGACGCCACCGGAAAGCCGTCTACTCGAGGCGATAAGGCCTGGGT
TCGCCAAGCCTGCCTCGCTAGCCTCGAGCGTCTTGGCGTTGACCACGTCGACCTCTACTACCAGCACCGCGTGGACCCGG
CCGTGCCCATCGAGGAGACGGTGCAGGCCATGGTGGAGCTGAAGAACGAGGGCAAGATACGTTATCTCGGGCTCTCCGAG
TGTTCCGCCGCAACTCTGCGAAGGGCGTGCGCTGTCCACCCTATCGCCGCCGCCCAGATGGAATTCTCACCTTTTGCACT
CGAGATCGAATCGGAACAGACCAAATTCCTGCAAACCGCGCGCGAACTGGGCGTCAAGATCGTCGTCTACTCTCCGCTGG
GACGTGGATTCTTGACCGGTGGCATCAAGAGCCGAGCTGACCTCGACGCCGGTGACAACCGCCATAACCATCCGCGGTTC
TCAGAGCAGAATTTCAACGCCAACTTCGTACTCGTGGACAAGCTCTCTGCGATTGCCGAGAAGAAGGGATGCACACCTGC
ACAGCTGGTTCTGGCCTGGGTTCTGGCTCAAGGGTAAGTGATTACAATCAACGACTTGAAATACGTGATCCGGTATCCAA
GTGGGTATTGTCGCGTTACATCGATGCATGCATGTGTTGACGTGAACAGTGACGACTTCATTCCAATCCCCGGCACAAAG
AAGCTCAAATACCTTGAGCAGAATGCCAAGGCCGTCGATGTGACGCTCACAAAGGAGGAAGAAGCCGAGGTTCGCAAGAC
CATCGACAGTGTAGGCGGTTCCAAAGGCGACCGATACCCGGCGATTATGATGGAGACGCTTTTTGGTAACTCGCCCGAGC
TGAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62